Simonwro120 Week 3

From LMU BioDB 2017
Jump to: navigation, search

Electronic Laboratory Notebook

Hack-a-Page

With DevTools

Before-pic-biodb.png

Without DevTools

After-bioPic.png

The Genetic Code, by Way of the Web

curl Command

curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa

ExPASy Questions

Question 1

The server's response does have some links to other pages which include:

  • This is a link to a page full of text resembling code and titled Swiss Institute of Bioinformatics.
  • This is a link to an their logo.
  • This link is very similar to my first. Just another text page titled Swiss Institute of Bioinformatics.
  • This is a link to a wikipedia page explaining Open reading frames as they pertain to biology.
  • This link is similar to 1 and 3. Another text file, however this one is titles CSS for Genevian Resources.

Question 2

There are identifiers in the ExPASy translation server’s responses which include:

  • "sib_footer" identifier pointing to the bottom of the page.
  • "sib_headrer" identifier pointing towards the top of the page.
  • "pre_text" identifier naming the box where text may go.
  • "POST" identifier tells the browser how to contact the server.

Just the Answers Using the Command Line

curl "http://web.expasy.org/cgi-bin/translate/dna_aa?pre_text=cgatggtacatggagtccagtagccgtagtgatgagatcgatgagctagc&output=Verbose&code=Standard" | grep -E '<(BR|PRE)>' | sed 's/<[^>]*>//g'

Electronic Lab Notebook

For Hack-a-Page:

  • First I accessed a website of my choosing and right clicked in Google Chrome to induce the dropdown menu.
  • I then clicked on "Inspect" to bring up the developer tools.
  • I then found a paragraph located next to a linked image and chose that part of the website as my target for modification.
  • After that, all I had to do was find the right code, modify it in any way I saw fit, and take my screenshots.

For "curl" Commands:

  • First I looked over a few basic curl commands to get a feel for how it works.
  • I then searched for commands that would allow for user input, as well ass a command that would allow me to activate a button most likely associated to some kind of script.
  • After some research, I started to fiddle wit the command line.
  • To verify that my command was correct, I searched the the code that was returned by the terminal representing the amino acid chains and cross referenced them with the already known correct sequences.

List of Assignments

Week 1 Week 2 Week 3 Week 4 Week 5 Week 6 Week 7 Week 8 Week 9 Week 10 Week 11 Week 12 Week 13 Week 14 Week 15

List of Journal Entries

Week 1 Week 2 Week 3 Week 4 Week 5 Week 6 Week 7 Week 8 Week 9 Week 10 Week 11 Week 12 Week 13 Week 14 Week 15

List of Shared Journals

Week 1 Week 2 Week 3 Week 4 Week 5 Week 6 Week 7 Week 8 Week 9 Week 10 Week 11 Week 12 Week 13 Week 14 Week 15

Acknowledgements

  • Thanks to Doctors Dahquist and Dondi to helping clarify the assignments instructions.
  • Thanks to "subfuzion' an account name for someone who helped me on gitHub.
  • Special thanks to Eddie Azinge and Blair Hamilton. With their help, I was able to learn what the "sed" command in curl was capable of.
  • Worked with partner to go over questions and complete assignment.
  • Although all those listed above contributed to my completing this work, all of its contents came from me alone.
  • I used the website http://www.beardeddragonguide.com as the website I modified and took screen shots of.

References

Retrieved from "https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php?title=Simonwro120_Week_3&oldid=1622"