Kzebrows Week 2

From LMU BioDB 2015
Jump to: navigation, search

Journal Assignment, Week 2

Given DNA strand:

5’-cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta-3’

Complementary strand:

3'-gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat -5'

Translation of all possible reading frames of this DNA sequence:

Top strand (mRNA-like):

5'-cgu aug cua aua cca ugu ucc gcg uau aac cca gcc gcc agu ucc gcu ggc ggc auu uua-3' 

+1 translates to

5'-R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L-3'

whereas +2

5'-gua ugc uaa uac cau guu ccg cgu aua acc cag ccg cca guu ccg cug gcg gca uuu-3'

translates to

5'-V-C-stop-3'

whereas 3+

5'-uau gcu aau acc aug uuc cgc gua uaa ccc agc cgc cag uuc cgc ugg cgg cau-3'

translates to

5'-T-A-N-T-M-F-R-V-stop-3'


Bottom strand (template) translates to:

3'-gca tac gat tat ggt aca agg cgc ata ttg ggt cgg cgg tca agg cga ccg ccg taa aat 5'

Read 5' to 3', this sequence looks like this:

5'-taa aat gcc gcc agc gga act ggc ggc tgg gtt ata cgc gga aca tgg tat tag cat acg-3'

Translated into mRNA, this sequence looks like this:

5'-uaa aau gcc gcc agc gga acu ggc ggc ugg guu aua cgc gga aca ugg uau uag cau acg-3'

In the -1 reading frame, this translates into:

5'-stop-3'

In the -2 reading frame this translates into:

5'-aaa aug ccg cca gcg gaa cug gcg gcu ggg uua uac gcg gaa cau ggu auu agc aua -3'

This translates into:

5'-K-M-P-P-A-E-L-A-A-G-L-Y-A-E-H-G-I-S-I-3'

In the -3 reading frame

5'-aaa ugc cgc cag cgg aac ugg cgg cug ggu uau acg cgg aac aug gua uua gca uac-3'

This translates into:

5'-K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y-3'

Which of the reading frames (if any) of the reading frames you translated is an open reading frame, i.e., does not contain a stop codon?

+1, -2, and -3 do not contain stop codons and are therefore open reading frames. This makes sense because -1, +2, and +3 do contain stop codons, and they are the opposite of each other (antisense).

Assignments

Individual Journal Assignment Pages

Week 1
Week 2
Week 3
Week 4
Week 5
Week 6
Week 7
Week 8
Week 9
Week 10
Week 11
Week 12
Week 14
Week 15

Individual Journal Assignments

Kzebrows Week 1
Kzebrows Week 2
Kzebrows Week 3
Kzebrows Week 4
Kzebrows Week 5
Kzebrows Week 6
Kzebrows Week 7
Kzebrows Week 8
Kzebrows Week 9
Kzebrows Week 10
Kzebrows Week 11
Kzebrows Week 12
Kzebrows Week 14
Kzebrows Week 15
Final Individual Reflection

Shared Journal Assignments

Class Journal Week 1
Class Journal Week 2
Class Journal Week 3
Class Journal Week 4
Class Journal Week 5
Class Journal Week 6
Class Journal Week 7
Class Journal Week 8
Class Journal Week 9
Oregon Trail Survivors Week 10
Oregon Trail Survivors Week 11
Oregon Trail Survivors Week 12
Oregon Trail Survivors Week 14

Additional Links

User Page: Kristin Zebrowski
Class Page: BIOL/CMSI 367-01
Team Page: Oregon Trail Survivors