New pages
- 23:22, 13 December 2013 Stephen Louie Deliverables (hist) [2,194 bytes] Slouie (Talk | contribs) (added content)
- 22:43, 13 December 2013 Tauras' Assessment and Reflection (hist) [9,213 bytes] Taur.vil (Talk | contribs) (start of page and some files)
- 21:59, 13 December 2013 TATK Final Group Deliverables (hist) [1,227 bytes] Taur.vil (Talk | contribs) (Page Creation minus group report file)
- 21:48, 13 December 2013 Miles Malefyt deliverables (hist) [2,979 bytes] Mmalefyt (Talk | contribs) (Created page with "==Statement of work==")
- 18:53, 13 December 2013 Alina's Assessment and Reflection (hist) [6,801 bytes] Ajvree (Talk | contribs) (initial format)
- 11:44, 13 December 2013 Team H(oo)KD Final Project Deliverables (hist) [2,040 bytes] Ksherbina (Talk | contribs) (Added template)
- 07:33, 13 December 2013 Streptococcus pneumoniae TIGR4 20131125 GeneTestingReport (hist) [5,078 bytes] Taur.vil (Talk | contribs) (new page name)
- 03:24, 13 December 2013 Personal Assessment (hist) [346 bytes] Lena (Talk | contribs) (Created page with "Media:Leishmania PersonalAssesment 12122013 Hunt.pdf")
- 19:12, 12 December 2013 Kevin's Assessment and Reflection (hist) [4,281 bytes] Kmeilak (Talk | contribs) (Created page with "==Statement of Work== I compiled the raw data into one excel file 20131119_teamATK_KM_compiledrawdata.xls")
- 06:33, 12 December 2013 Kevin McGee Assessment and Reflection (hist) [7,588 bytes] Kevinmcgee (Talk | contribs) (Created page with "Statement of Work Describe exactly what you did on the project. Kevinmcgee Week 10 # #*I used the PubMed database to find the reference geneome of Leishmania Major. #*I se...")
- 00:24, 12 December 2013 Laurmagee: Individual Assessment (hist) [10,772 bytes] Laurmagee (Talk | contribs) (Added Assessment Format)
- 23:37, 11 December 2013 Team Name Deliverables (hist) [2,428 bytes] Slouie (Talk | contribs) (Started on deliverables page)
- 10:51, 11 December 2013 Vkuehn Individual Assessment and Reflection (hist) [6,196 bytes] Vkuehn (Talk | contribs) (Created page with "=== Statement of Work === * Describe exactly what you did on the project. * Provide references or links to artifacts of your work, such as: ** Wiki pages ** Other files or do...")
- 01:23, 11 December 2013 Final Project Deliverables (hist) [1,086 bytes] Lena (Talk | contribs) (Created page with " GenMAPP Gene Database for assigned species (.gdb) ReadMe file to accompany the Gene Database (.pdf) Sample ReadMe in Word format: ReadMe_Vc-Std_External_20131122.zip Include ...")
- 23:44, 10 December 2013 Individual Assessment and Reflection (hist) [3,426 bytes] Mpetredi (Talk | contribs) (added some responses to individual assessment and reflection)
- 19:02, 5 December 2013 Teamname Week 15 Status Report (hist) [2,428 bytes] Laurmagee (Talk | contribs) (Created page with "=='''Team Name'''== =='''Lauren Magee''': Reflection Questions==")
- 18:56, 5 December 2013 Leishmania major Week 15 Status Report (hist) [2,701 bytes] Vkuehn (Talk | contribs) (week 15 made)
- 18:29, 5 December 2013 Kmeilak Week 15 (hist) [19,031 bytes] Kmeilak (Talk | contribs) (Created page with "==Electronic Lab Journal== == Map Onto Biological Pathways (GenMAPP & MAPPFinder) == '''Fall 2013:''' Beginning point for class on Tuesday, October 15 as part of the [https...")
- 18:17, 5 December 2013 Team H(oo)KD Week 15 Status Report (hist) [6,248 bytes] Ksherbina (Talk | contribs) (Added template)
- 18:14, 5 December 2013 Vkuehn Week 15 (hist) [3,023 bytes] Vkuehn (Talk | contribs) (Created page with "=='''ELECTRONIC NOTEBOOK'''== ==12/5/13== ===Sanity Check=== *P-value less than 0.05: 5303 *P-value less that 0.01: 2130 *P-value less that 0.001: 317 *P-value less that 0.00...")
- 18:13, 5 December 2013 Kmeilak Week 14 (hist) [10,626 bytes] Kmeilak (Talk | contribs) (Created page with "==Electronic Lab Notebook== ===11/29/13=== *Continued to manipulate raw data as described here [http://www.openwetware.org/wiki/BIOL398-01/S10:Sample_Microarray_Analysis_Vib...")
- 18:02, 5 December 2013 Kevinmcgee Week 15 (hist) [1,812 bytes] Kevinmcgee (Talk | contribs) (Added Sanity Check)
- 17:47, 5 December 2013 Taur.vil Week 15 (hist) [794 bytes] Taur.vil (Talk | contribs) (Created page and started inputting information)
- 19:10, 3 December 2013 Ajvree Week 15 (hist) [1,384 bytes] Ajvree (Talk | contribs) (excel comparison info)
- 19:03, 3 December 2013 Leishmania Major Group Project Report (hist) [1,606 bytes] Lena (Talk | contribs) (Created page with "'''Methods''' :'''Data Source Files''' :The Uniprot XML proteome set was downloaded from the Uniprot complete proteomes page for Leishmania major. We used the version that w...")
- 18:50, 3 December 2013 Gleis Week 15 (hist) [789 bytes] Gleis (Talk | contribs) (Created page with "==Lab Journal== *Code needed ID changes in Eclipse *Replaced first period with an "_" and removed second "_" *Replaced to look like "LMJF_##_####"")
- 18:28, 3 December 2013 Laurmagee: Week 15 (hist) [17,836 bytes] Laurmagee (Talk | contribs) (Added Sanity)
- 18:23, 3 December 2013 Electronic notebook: sinorhizobium meliloti (hist) [3,799 bytes] Mmalefyt (Talk | contribs) (Created page with "==Week 12== *Read the paper on the salinity and sucrose stress on gene expression *Sorted the raw data into an XML file")
- 18:03, 3 December 2013 TATK Week 15 Status Report (hist) [1,216 bytes] Kmeilak (Talk | contribs) (Created page with "==12/3/13== *numbers of significant p-values by hour for TIGR4 #4hr - 1218 #")
- 17:08, 3 December 2013 Mpetredi Week 14 (hist) [974 bytes] Mpetredi (Talk | contribs) (notes about new string of code and start of new import/export process)
- 19:13, 26 November 2013 Gleis Week 14 (hist) [839 bytes] Gleis (Talk | contribs) (Created page with "==To Do List== *Identify new URL pattern *Fix import/export issues *Fix ID code *Tally Engine code not showing Ordered Locus")
- 18:50, 26 November 2013 Ajvree Week 14 (hist) [602 bytes] Ajvree (Talk | contribs) (og row counts, template)
- 06:58, 26 November 2013 Taur.vil Week 14 (hist) [649 bytes] Taur.vil (Talk | contribs) (IE C4)
- 06:57, 26 November 2013 TATK E4: TIGR4 Testing Report (hist) [5,078 bytes] Taur.vil (Talk | contribs) (started up til export)
- 01:04, 22 November 2013 Team H(oo)KD Week 13 Status Report (hist) [7,866 bytes] Ksherbina (Talk | contribs) (Added template)
- 20:35, 21 November 2013 Laurmagee: Week 13 (hist) [3,237 bytes] Laurmagee (Talk | contribs) (Created page with "The following link is to the Sinorhizobium meliloti team page: Team Name * ~~~~ Category: Journal EntryCategory: Sinorhizobium meliloti")
- 19:29, 21 November 2013 Teamname Week 13 Status Report (hist) [4,764 bytes] Laurmagee (Talk | contribs) (Created page with "=='''Team Name'''== =='''Lauren Magee''': Reflection Questions== Category:Journal Entry")
- 05:49, 21 November 2013 TATK Week 13 Status Report (hist) [3,001 bytes] Kmeilak (Talk | contribs) (Created page with "===Week Goals and Status Report=== 1. ===Next Steps=== ===Goals for Next Week=== ===Deliverables=== ====Group==== ====Individuals==== ===Team Reflections===")
- 05:26, 21 November 2013 TATK E3: TIGR4 Testing Report (hist) [5,402 bytes] Taur.vil (Talk | contribs) (start of IE cycle)
- 18:32, 19 November 2013 Kmeilak Week 13 (hist) [804 bytes] Kmeilak (Talk | contribs) (Created page with "==Electronic Lab Notebook== ===11/19/2013=== *Created compiled raw data file using the following steps #Opened first of 18 raw data files in excel #Opened blank excel sprea...")
- 18:28, 19 November 2013 Gleis Week 13 (hist) [688 bytes] Gleis (Talk | contribs) (Created page with "==Lab Journal== *Identified database link pattern: :*http://www.genedb.org/gene/~ *Customized species profile :*Linked Ordered Locus Names to ORF :*Updated Species Database Li...")
- 18:18, 19 November 2013 Leishmania major Week 13 Status Report (hist) [3,358 bytes] Gleis (Talk | contribs) (Created page with "==Import/Export GenMAPP== Name:Leishmania_major_18112013 ===Export Information=== :Uniprot: : :GO OBO: : :GOA: : ===Tally Engine=== ===Original Row Counts Comparison===")
- 18:02, 19 November 2013 Ajvree Week 13 (hist) [3,806 bytes] Ajvree (Talk | contribs) (began week 13 counting info)
- 17:59, 19 November 2013 Mpetredi Week 13 (hist) [1,602 bytes] Mpetredi (Talk | contribs) (added links to model organism database)
- 17:42, 19 November 2013 Mpetredi Week 12 (hist) [297 bytes] Mpetredi (Talk | contribs) (added info about week 12 assignment)
- 17:41, 19 November 2013 Kevinmcgee Week 13 (hist) [1,853 bytes] Kevinmcgee (Talk | contribs) (Began electronic journal)
- 17:34, 19 November 2013 Data Information (hist) [2,792 bytes] Kmeilak (Talk | contribs) (Created page with "==corresponding data files to ID and sample excel file== *GSM664117_14090187_control_Cy3_48_hr_Cy5 = 48hr_Cy5_control_Cy3_1")
- 09:25, 19 November 2013 Vkuehn Week 13 (hist) [2,570 bytes] Vkuehn (Talk | contribs) (created page)
- 06:54, 19 November 2013 Taur.vil Week 13 (hist) [3,849 bytes] Taur.vil (Talk | contribs) (TIGR4 E2)
- 06:52, 19 November 2013 TATK E2: TIGR4 Testing Report (hist) [3,965 bytes] Taur.vil (Talk | contribs) (started page TIGR4 E2)
- 17:39, 18 November 2013 TATK Export One: TIGR4 Testing Report (hist) [5,183 bytes] Taur.vil (Talk | contribs) (Filled out information for Export)
- 08:03, 15 November 2013 Vkuehn Week 12 (hist) [1,541 bytes] Vkuehn (Talk | contribs) (Week 12 electronic notebook)
- 05:07, 15 November 2013 TATK Week 12 Status Report (hist) [5,999 bytes] Taur.vil (Talk | contribs) (Tauras' Reflection on week 12 status report)
- 04:57, 15 November 2013 Stephen Louie Project Notebook (hist) [3,278 bytes] Slouie (Talk | contribs) (Created Project Notebook)
- 18:46, 14 November 2013 Team Journal Assignment Week 12 (hist) [509 bytes] HDelgadi (Talk | contribs) (added signature)
- 18:42, 14 November 2013 Team H(oo)KD Week 12 Individual Status Reports (hist) [131 bytes] Dwilliams (Talk | contribs) (Created Week 12 Individual Status Report Page)
- 18:39, 14 November 2013 Team ATK Week 12 Progress Report (hist) [1,245 bytes] Kmeilak (Talk | contribs) (Created page with "=='''Kevin Meilak'''== ===11/12/13=== *In class presentations took up the entire work day, no direct project work done ===11/14/13=== *Reread materials and met...")
- 18:37, 14 November 2013 Kevinmcgee Week 12 (hist) [775 bytes] Kevinmcgee (Talk | contribs) (Added image)
- 18:29, 14 November 2013 H(oo)KD Week 12 Status Report (hist) [130 bytes] HDelgadi (Talk | contribs) (adding signature and linking team page)
- 18:25, 14 November 2013 Dwilliams Project Notebook (hist) [8,419 bytes] Dwilliams (Talk | contribs) (Added weeks to notebook)
- 18:23, 14 November 2013 DwilliamsProject Notebook (hist) [24 bytes] Dwilliams (Talk | contribs) (Added weeks to notebook)
- 18:09, 14 November 2013 Ajvree Week 12 (hist) [716 bytes] Ajvree (Talk | contribs) (began Access counting)
- 17:53, 14 November 2013 Leishmania major Week 12 Status Report (hist) [4,495 bytes] Lena (Talk | contribs) (Created page with "Status Report")
- 17:48, 14 November 2013 Gleis Week 12 (hist) [1,342 bytes] Gleis (Talk | contribs) (Created page with "Eclipse>workbench>+canister>follow coder instructions")
- 17:42, 14 November 2013 HDelgadi Project Notebook (hist) [8,546 bytes] HDelgadi (Talk | contribs) (week 12,13,14)
- 17:36, 14 November 2013 Lena Project Notebook (hist) [5,456 bytes] Lena (Talk | contribs) (added weeks)
- 17:27, 14 November 2013 Kmeilak Week 12 (hist) [1,857 bytes] Kmeilak (Talk | contribs) (Created page with "==Electronic Lab Journal== ===11/12/13=== In class presentations took up the entire work day, no direct project work done. ===11/14/13===")
- 04:55, 14 November 2013 Taur.vil Week 12 (hist) [4,245 bytes] Taur.vil (Talk | contribs) (G54 initial gmBuilder run)
- 04:23, 14 November 2013 Ksherbina Project Notebook (hist) [28,892 bytes] Ksherbina (Talk | contribs) (Added sections and template)
- 20:44, 13 November 2013 Laurmagee: Week 12 (hist) [812 bytes] Laurmagee (Talk | contribs) (Created page with "Category: Journal EntryCategory: Team Name")
- 20:32, 13 November 2013 Team Name Week 12 (hist) [3,730 bytes] Laurmagee (Talk | contribs) (Created page with "===Team Name=== ==Lauren Magee: Reflection Questions== # What were the week’s key accomplishments? # What are next week’s target accomplishments? # What team strengths...")
- 02:02, 12 November 2013 Dwilliams Week 11 assignment (hist) [15,121 bytes] Dwilliams (Talk | contribs) (Created Week 11 Assignment Page)
- 01:58, 12 November 2013 Genome paper Sinorhizonium Meliloti (hist) [6,561 bytes] Mmalefyt (Talk | contribs) (Created page with "==Terms== *'''Megaplasmid''' - Genomic material that is not found in the chromosome that contains 100kb or more of information. Usually found in highly diverse species of bact...")
- 22:59, 11 November 2013 HDelgadi Week 11 (hist) [9,972 bytes] HDelgadi (Talk | contribs) (adding definition title)
- 19:50, 11 November 2013 Mpetredi Week 11 (hist) [10,356 bytes] Mpetredi (Talk | contribs) (added categories)
- 05:00, 11 November 2013 Kevinmcgee Week 11 (hist) [4,878 bytes] Kevinmcgee (Talk | contribs) (Added unknown terms)
- 22:06, 10 November 2013 Kmeilak Week 11 (hist) [7,457 bytes] Kmeilak (Talk | contribs) (Created page with "==Preparation for Journal Club on Streptococcus pneumoniae== ===10 novel biological terms=== #isolate - #lactococci - #beta-hemolytic - #otitis media - #spoolings - #fo...")
- 03:24, 10 November 2013 Vkuehn Week 11 (hist) [11,900 bytes] Vkuehn (Talk | contribs) (Created page, outlined intro)
- 21:59, 8 November 2013 Ksherbina Week 11 (hist) [14,545 bytes] Ksherbina (Talk | contribs) (Added template)
- 01:02, 8 November 2013 Team H(oo)KD Week 12 Status Report (hist) [2,449 bytes] Ksherbina (Talk | contribs) (Added description of page and sections) originally created as "Team H(oo)KD Electronic Lab Notebook"
- 18:44, 7 November 2013 Stephen Louie Week 11 (hist) [8,543 bytes] Slouie (Talk | contribs) (Added terms)
- 18:12, 7 November 2013 Laurmagee: Week 11 (hist) [7,362 bytes] Laurmagee (Talk | contribs) (Template for Jounral)
- 17:49, 7 November 2013 Gleis Week 11 (hist) [9,095 bytes] Gleis (Talk | contribs) (Created page with "==GO Terms==")
- 17:47, 7 November 2013 Ajvree Week 11 (hist) [7,360 bytes] Ajvree (Talk | contribs) (strain ids)
- 17:37, 7 November 2013 Lena Week 11 (hist) [10,023 bytes] Lena (Talk | contribs) (Created page with "'''The Genome of the Kinetoplastid Parasite, ''Leishmania major.'' '''")
- 18:42, 5 November 2013 The Plan (hist) [1,655 bytes] Vkuehn (Talk | contribs) (Created timeline page)
- 18:27, 5 November 2013 Individual hw week 10 (hist) [2,512 bytes] Mmalefyt (Talk | contribs) (Created page with "==Class Notes week 10== *To access database pages go through the LMU link *journal availibility comes through PubMed central if it is funded by the government ==Open Access J...")
- 18:04, 5 November 2013 Taur.vil Week 11 (hist) [10,668 bytes] Taur.vil (Talk | contribs) (creating and proj manager meeting)
- 17:50, 5 November 2013 Team Name (hist) [11,998 bytes] Slouie (Talk | contribs) (Edited Team page)
- 17:47, 5 November 2013 In Class Notes Week 11 (hist) [144 bytes] Dwilliams (Talk | contribs) (Added Notes for week 11)
- 01:42, 1 November 2013 HDelgadi Week 10 (hist) [2,080 bytes] HDelgadi (Talk | contribs) (updating electronic notebook)
- 17:27, 31 October 2013 Leishmania Major Articles (hist) [7,807 bytes] Kevinmcgee (Talk | contribs) (Added articles to page)
- 17:25, 31 October 2013 Leishmania Marjor Articles (hist) [0 bytes] Kevinmcgee (Talk | contribs) (Added articles to page)
- 17:12, 31 October 2013 Taur.vil Week 10 (hist) [5,992 bytes] Taur.vil (Talk | contribs) (journal through first paper)
- 17:10, 31 October 2013 Stephen Louie Week 10 (hist) [1,447 bytes] Slouie (Talk | contribs) (Added lab notebook)
- 16:52, 31 October 2013 Dwilliams Week 10 assignment (hist) [3,452 bytes] Dwilliams (Talk | contribs) (Created page with "==Electronic Journal Week 10==")
- 00:51, 31 October 2013 Ksherbina Week 10 (hist) [6,874 bytes] Ksherbina (Talk | contribs) (Added categories)
- 08:14, 30 October 2013 Laurmagee: Week 10 (hist) [3,925 bytes] Laurmagee (Talk | contribs) (Articles)
- 17:43, 29 October 2013 Kevinmcgee Week 10 (hist) [1,854 bytes] Kevinmcgee (Talk | contribs) (Created page with "# #*I used the PubMed database to find the reference geneome of Leishmania Major. #*I searched with the terms "Leishmania Major [MeSH Terms] AND Genome [Title]" #*The search t...")
- 17:19, 29 October 2013 Mpetredi Week 10 (hist) [4,359 bytes] Mpetredi (Talk | contribs) (added name and categories)
- 17:13, 29 October 2013 Vkuehn Week 10 (hist) [1,689 bytes] Vkuehn (Talk | contribs) (Created page with "possible article: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1470643/")
- 17:13, 29 October 2013 Kmeilak Week 10 (hist) [1,956 bytes] Kmeilak (Talk | contribs) (Created page with "==Electronic Lab Journal== 10/29/2013 *Accessed PubMed [http://www.ncbi.nlm.nih.gov/pubmed?holding=calmulib PubMed Homepage] *Did an advanced search for articles with Strept...")
- 17:03, 29 October 2013 Gleis Week 10 (hist) [1,309 bytes] Gleis (Talk | contribs) (Created page with "==Lab Journal== *Opened Week 10 assignment page *Followed this link, http://libguides.lmu.edu/BIOL367 to the lib guide home page *opened pub med browser *Used the advanced...")
- 17:02, 29 October 2013 Lena Week 10 (hist) [2,422 bytes] Lena (Talk | contribs) (Created page with "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC310692/")
- 16:45, 29 October 2013 Sinorhizobium meliloti (hist) [3,958 bytes] Slouie (Talk | contribs) (Created team page)
- 16:30, 29 October 2013 Class Journal Week 10 (hist) [0 bytes] Mmalefyt (Talk | contribs) (Created page with "For this assignment, you will be creating an annotated bibliography of genomics papers for your team's species. Glenn Johnson-Grau will be giving a guest presentation in class...")
- 16:30, 29 October 2013 Streptococcus pneumoniae (hist) [12,290 bytes] Taur.vil (Talk | contribs) (started page)
- 16:24, 29 October 2013 Ajvree Week 10 (hist) [2,644 bytes] Ajvree (Talk | contribs) (began week 10 page)
- 01:32, 29 October 2013 Sinorhizobium melliloti (hist) [23 bytes] Taur.vil (Talk | contribs) (Opening page)
- 00:15, 29 October 2013 Chlamydia trachomatis (hist) [15,870 bytes] HDelgadi (Talk | contribs) (adding general information about the team)
- 17:56, 24 October 2013 Leishmania major (hist) [8,548 bytes] Gleis (Talk | contribs) (Created page with "='''Team 3'''= =='''Leishmania Major'''==")
- 17:54, 24 October 2013 ''Leishmania major'' (hist) [10 bytes] Gleis (Talk | contribs) (Created page with "Leishmania major")
- 17:51, 24 October 2013 Placeholder Team 3 (hist) [16 bytes] Gleis (Talk | contribs) (Created page with "Leishmania major")
- 16:28, 24 October 2013 Kevinmcgee Week 9 (hist) [6,348 bytes] Kevinmcgee (Talk | contribs) (Added work from tuesday)
- 16:49, 22 October 2013 Ksherbina Week 9 (hist) [11,874 bytes] Ksherbina (Talk | contribs) (Added template to record export information)
- 16:42, 22 October 2013 HDelgadi Week 9 (hist) [6,287 bytes] HDelgadi (Talk | contribs) (Cholerae file)
- 16:41, 22 October 2013 Dwilliams Week 9 assignment (hist) [5,648 bytes] Dwilliams (Talk | contribs) (Added Gene Database Testing)
- 16:41, 22 October 2013 TV test (hist) [4,477 bytes] Taur.vil (Talk | contribs) (Pasting testing report sample)
- 16:40, 22 October 2013 Taur.vil Week 9 (hist) [9,996 bytes] Taur.vil (Talk | contribs) (Created page with "TV_test")
- 16:40, 22 October 2013 Vkuehn Week 9 (hist) [8,213 bytes] Vkuehn (Talk | contribs) (copy paste)
- 16:40, 22 October 2013 Gleis Week 9 (hist) [7,827 bytes] Gleis (Talk | contribs) (Template)
- 16:40, 22 October 2013 Ajvree Week 9 (hist) [1,541 bytes] Ajvree (Talk | contribs) (gene database report)
- 16:40, 22 October 2013 Dondi Week 9 (hist) [4,292 bytes] Dondi (Talk | contribs) (Initial version of 2013 V. cholerae gene database export report.)
- 16:40, 22 October 2013 Laurmagee: Week 9 (hist) [6,359 bytes] Laurmagee (Talk | contribs) (Template)
- 16:40, 22 October 2013 Individual hw week 9 (hist) [4,308 bytes] Mmalefyt (Talk | contribs) (Created page with "==Export Information== Version of GenMAPP Builder: Computer on which export was run: Postgres Database name: UniProt XML filename: * UniProt XML version (The version infor...")
- 16:40, 22 October 2013 Stephen Louie Week 9 (hist) [7,273 bytes] Slouie (Talk | contribs) (Add week 9)
- 16:37, 22 October 2013 Lena Week 9 (hist) [5,069 bytes] Lena (Talk | contribs) (Created page with "==Download and Extract Data Source Files== ===UniProt XML=== ===GOA===")
- 16:36, 22 October 2013 Kmeilak Week 9 (hist) [7,073 bytes] Kmeilak (Talk | contribs) (Created page with "==Electronic Lab Journal== 10/22/13 *Went to [http://www.uniprot.org/taxonomy/complete-proteomes UniProt Complete Proteomes] page * {{Kmeilak}} Category:Journal Entry")
- 14:53, 22 October 2013 Mpetredi Week 9 (hist) [8,580 bytes] Mpetredi (Talk | contribs) (added categories and user page link)
- 07:37, 22 October 2013 GeneDB (hist) [4,358 bytes] Laurmagee (Talk | contribs) (Added Information)
- 07:31, 22 October 2013 Class Journal Week 9 (hist) [14,904 bytes] Laurmagee (Talk | contribs) (Add Team Work)
- 05:56, 18 October 2013 Laurmagee: Week 8 (hist) [15,228 bytes] Laurmagee (Talk | contribs) (Added Links!)
- 17:39, 15 October 2013 Dwilliams Week 8 assignment (hist) [7,929 bytes] Dwilliams (Talk | contribs) (Added info)
- 03:08, 14 October 2013 Individual hw week 8 (hist) [2,603 bytes] Mmalefyt (Talk | contribs) (Created page with "''part 1 text file''<br> [[Media:")
- 20:58, 13 October 2013 Kevinmcgee Week 8 (hist) [4,316 bytes] Kevinmcgee (Talk | contribs) (Created page with "Digital Notebook #Downloaded the Stanford Microarray Database data. #Made a new page called scaled_centered. Copied data from previous page, and calculated average ( =AVERAGE(...")
- 05:38, 13 October 2013 HDelgadi Week 8 (hist) [15,854 bytes] HDelgadi (Talk | contribs) (digital lab notebook title)
- 05:07, 11 October 2013 Lena Week 8 (hist) [4,105 bytes] Lena (Talk | contribs) (added data sheets)
- 05:00, 11 October 2013 Dwilliams week 7 assignment (hist) [2,804 bytes] Dwilliams (Talk | contribs) (Added Assignment week 7)
- 04:35, 11 October 2013 Gleis Week 8 (hist) [14,747 bytes] Gleis (Talk | contribs) (Created page with "==Vibrio cholerae statistical analysis==")
- 04:34, 11 October 2013 Stephen Louie Week 8 (hist) [12,772 bytes] Slouie (Talk | contribs) (Created Individual Journal Entry)
- 04:33, 11 October 2013 Class Journal Week 8 (hist) [26,064 bytes] Slouie (Talk | contribs) (Created Individual Journal Entry)
- 19:49, 10 October 2013 Mpetredi Week 8 (hist) [15,071 bytes] Mpetredi (Talk | contribs) (added links to necessary files)
- 17:45, 10 October 2013 Lena Week 7 (hist) [2,349 bytes] Lena (Talk | contribs) (txt uploaded)
- 17:35, 10 October 2013 Ajvree Week 8 (hist) [4,321 bytes] Ajvree (Talk | contribs) (uploaded/linked to part 1 excel file)
- 17:30, 10 October 2013 Taur.vil Week 8 (hist) [14,376 bytes] Taur.vil (Talk | contribs) (page creation and start of digital notebook)
- 17:29, 10 October 2013 Vkuehn Week 8 (hist) [7,017 bytes] Vkuehn (Talk | contribs) (Created page with "==='''Electronic Lab Notebook'''=== uploaded txt file and excel file:")
- 17:05, 10 October 2013 Kmeilak Week 8 (hist) [11,971 bytes] Kmeilak (Talk | contribs) (Created page with "==Overview of Microarray Data Analysis== Electronic Lab Notebook *Downloaded Merrill Compiled Raw Data file from [http://www.openwetware.org/wiki/BIOL398-01/S10:Sample_Micro...")
- 16:54, 10 October 2013 Ksherbina Week 8 (hist) [20,840 bytes] Ksherbina (Talk | contribs) (Added template and categories.)
- 16:49, 10 October 2013 Class Notes 3 (hist) [414 bytes] Mpetredi (Talk | contribs) (Created page with "10/10/13 *Biological Replicates: independent biological samples **Examples: Patient A, B, C ***should have at least 3 or more replicates *technical replicate: split a sample ...")
- 16:45, 10 October 2013 Notes Week 7 (hist) [92 bytes] Lena (Talk | contribs) (Created page with "MerrellCompiledRawDataVibrio_LHunt2013.xls")
- 04:25, 10 October 2013 Mpetredi Week 7 (hist) [2,255 bytes] Mpetredi (Talk | contribs) (Added answers to 6b)
- 04:13, 10 October 2013 Stephen Louie Week 7 (hist) [1,665 bytes] Slouie (Talk | contribs) (Created Individual Journal Entry)
- 03:18, 10 October 2013 Ajvree Week 7 (hist) [3,494 bytes] Ajvree (Talk | contribs) (began individual hw)
- 03:17, 10 October 2013 Individual hw week 7 (hist) [3,684 bytes] Mmalefyt (Talk | contribs) (Created page with "5. (p. 110) Choose two genes from Figure 4.6 (PDF of figures on MyLMUConnect) and draw a graph to represent the change in transcription over time. * Note: You can do this...")
- 01:34, 10 October 2013 HDelgadi Week 7 (hist) [4,214 bytes] HDelgadi (Talk | contribs) (added questions)
- 00:27, 10 October 2013 Kevinmcgee Week 7 (hist) [1,589 bytes] Kevinmcgee (Talk | contribs) (Added graph)
- 00:24, 10 October 2013 Gleis Week 7 (hist) [2,421 bytes] Gleis (Talk | contribs) (Created page with "==Introduction to MicroArrays== 5. image:Mrna-expression.jpg")
- 19:32, 9 October 2013 Vkuehn Week 7 (hist) [3,454 bytes] Vkuehn (Talk | contribs) (created week 7)
- 07:13, 9 October 2013 Ksherbina Week 7 (hist) [3,070 bytes] Ksherbina (Talk | contribs) (Added template.)
- 06:03, 9 October 2013 Taur.vil Week 7 (hist) [2,890 bytes] Taur.vil (Talk | contribs) (Inserting image)
- 00:18, 9 October 2013 Kmeilak Week 7 (hist) [4,199 bytes] Kmeilak (Talk | contribs) (Created page with "==Discovery Questions from Chapter 4== 5. {{Kmeilak}} Category:Journal Entry")
- 20:29, 8 October 2013 Laurmagee: Week 7 (hist) [2,115 bytes] Laurmagee (Talk | contribs) (Added Formate)
- 20:23, 8 October 2013 Class Journal Week 7 (hist) [19,157 bytes] Laurmagee (Talk | contribs) (Added Page and Questions)
- 04:35, 4 October 2013 Protegen (hist) [193 bytes] Mpetredi (Talk | contribs) (added content to protegen page)
- 01:00, 4 October 2013 Stephen Louie Week 6 (hist) [3,806 bytes] Slouie (Talk | contribs) (Created Journal Entry)
- 00:16, 4 October 2013 Dwilliams week 6 assignment (hist) [4,951 bytes] Dwilliams (Talk | contribs) (Added Assignment week 6)
- 22:24, 3 October 2013 Individual HW week 5 (hist) [1,089 bytes] Mmalefyt (Talk | contribs) (Created page with "==EGFR Protein== This protein is used in a cascade sequence and acts as a receptor protein in that pathway. It is also present in the lungs when cancer is present. It plays a ...")
- 19:08, 3 October 2013 Individual hw week 6 (hist) [3,584 bytes] Mmalefyt (Talk | contribs) (Created page with "'''1.) What movies were released before 1915?''' select * from movie where year < 1915 #D.W. Griffith: Years of Discovery 1909-1913 #Lumiere Brothers' First Films #Tillie's...")
- 18:55, 3 October 2013 Gleis Week 6 (hist) [3,604 bytes] Gleis (Talk | contribs) (Created page with "==Movies from Text File to Tables== #")
- 17:54, 3 October 2013 Vkuehn Week 6 (hist) [5,629 bytes] Vkuehn (Talk | contribs) (Started questions)
- 17:02, 3 October 2013 Lena Week 6 (hist) [4,448 bytes] Lena (Talk | contribs) (Created page with "1.) What movies were released before 1915? "D.W. Griffith: Years of Discovery 1909-1913" "Lumiere Brothers' First Films" "Tillie's Punctured Romance" "Cabiria" 2.)")
- 08:37, 1 October 2013 Class Journal Week 6 (hist) [25,370 bytes] Laurmagee (Talk | contribs) (Added Page and Questions)
- 01:32, 30 September 2013 Spliceosome Database (hist) [3,394 bytes] Kmeilak (Talk | contribs) (Created page with "#I accessed the Spliceosome Database [http://spliceosomedb.ucsc.edu/ Spliceosome Database] #The purpose of this database is to unify and simplify the many (over 200) proteins ...")
- 21:07, 29 September 2013 Ensembl Database (hist) [3,468 bytes] Vkuehn (Talk | contribs) (Database page started. Some questions answered)
- 04:04, 27 September 2013 Stephen Louie Week 5 (hist) [3,062 bytes] Slouie (Talk | contribs) (Began journal entry)
- 03:48, 27 September 2013 Dwilliams week 5 assignment (hist) [985 bytes] Dwilliams (Talk | contribs) (Added week 5 assignment)
- 03:42, 27 September 2013 Vkuehn Week 5 (hist) [2,514 bytes] Vkuehn (Talk | contribs) (Got started)
- 00:33, 27 September 2013 PrePPI (hist) [4,166 bytes] Ksherbina (Talk | contribs) (Added some sections and links to the user pages of the authors in the presentation section.)
- 22:58, 26 September 2013 OrganelleDB (hist) [2,294 bytes] Ajvree (Talk | contribs) (began database page, answered some questions)
- 18:39, 26 September 2013 Laurmagee: Week 5 (hist) [5,588 bytes] Laurmagee (Talk | contribs) (Created page with " Category:Jounral Entry")
- 18:27, 26 September 2013 HDelgadi Week 5 (hist) [4,022 bytes] HDelgadi (Talk | contribs) (updating answers)
- 18:04, 26 September 2013 Ajvree Week 6 (hist) [2,553 bytes] Ajvree (Talk | contribs) (created week 6 page)
- 17:53, 26 September 2013 Lena Week 5 (hist) [4,760 bytes] Lena (Talk | contribs) (Created page with "==Electronic Journal for Uniprot exercise== *searched for P00533")
- 17:36, 26 September 2013 Ajvree Week 5 (hist) [2,384 bytes] Ajvree (Talk | contribs) (class notes)
- 17:29, 26 September 2013 Kevinmcgee Week 6 (hist) [2,946 bytes] Kevinmcgee (Talk | contribs) (Updated week 6 hw)
- 17:28, 26 September 2013 Taur.vil Week 6 (hist) [5,024 bytes] Taur.vil (Talk | contribs) (Start of assignment during class period)
- 17:14, 26 September 2013 Laurmagee: Week 6 (hist) [5,639 bytes] Laurmagee (Talk | contribs) (Added query information)
- 17:12, 26 September 2013 Kmeilak Week 6 (hist) [44,693 bytes] Kmeilak (Talk | contribs) (Created page with "==Movies from Text File to Tables== 1. What movies were released before 1915? *"D.W. Griffith: Years of Discovery 1909-1913" *"Lumiere Brothers' First Films" *"Tillie's Punc...")
- 17:09, 26 September 2013 HDelgadi Week 6 (hist) [8,556 bytes] HDelgadi (Talk | contribs) (Adding answer to first question)
- 17:08, 26 September 2013 Mpetredi Week 6 (hist) [4,358 bytes] Mpetredi (Talk | contribs) (Answered first question)
- 16:23, 26 September 2013 Ksherbina Week 6 (hist) [4,744 bytes] Ksherbina (Talk | contribs) (Added template.)
- 08:09, 26 September 2013 Taur.vil Week 5 (hist) [5,858 bytes] Taur.vil (Talk | contribs) (Started assignment--will check with professors tomorrow about accuracy)
- 00:29, 26 September 2013 Mpetredi Week 5 (hist) [4,908 bytes] Mpetredi (Talk | contribs) (Added very basic response to uniprot exercise. Will elaborate more later.)
- 18:17, 25 September 2013 TFClass (hist) [3,692 bytes] Taur.vil (Talk | contribs) (start page)
- 18:15, 25 September 2013 Class Journal Week 5 (hist) [20,728 bytes] Taur.vil (Talk | contribs) (Page Creation; group database)
- 02:21, 25 September 2013 Ksherbina Week 5 (hist) [6,739 bytes] Ksherbina (Talk | contribs) (Added template.)
- 00:21, 25 September 2013 Gleis Week 5 (hist) [1,734 bytes] Gleis (Talk | contribs) (Created page with "==E-Notebook== :*Obtained copy of Bioinformatics for Dummies Chapter 4")
- 16:58, 24 September 2013 Kevinmcgee Week 5 (hist) [1,654 bytes] Kevinmcgee (Talk | contribs) (Added part of uniprot exercise)
- 22:07, 22 September 2013 Vkuehn Week 4 (hist) [900 bytes] Vkuehn (Talk | contribs) (some labelled sites)
- 21:30, 22 September 2013 Kmeilak Week 5 (hist) [5,231 bytes] Kmeilak (Talk | contribs) (created UniProt Lab Journal)
- 06:16, 20 September 2013 Dwilliams week 4 assignment (hist) [2,904 bytes] Dwilliams (Talk | contribs) (Added homework answers for questions 1,2,3)
- 04:12, 20 September 2013 Gleis Week 4 (hist) [2,745 bytes] Gleis (Talk | contribs) (Created page with "=="Taken to the Next Level"== # :a) ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcg gtcgcagagttggttacgctcattaccccgctgccgataaggaatttttcgc gtcaggtaacgcccatcgtttatctc...")
- 04:09, 20 September 2013 Taur.vil Week 4 (hist) [3,956 bytes] Taur.vil (Talk | contribs) (Created page with "Week 4 Individual Journal 1) cat infA-E.coli-K12.txt | sed "s/cat[at]at/ <-10box> & <\/-10box> /g" | sed "s/................. <-10box>/ <\/-35box> &/g" |sed "s/....")
- 04:06, 20 September 2013 Stephen Louie Week 4 (hist) [3,265 bytes] Slouie (Talk | contribs) (Added Transcription and Translation)
- 00:15, 20 September 2013 HDelgadi Week 4 (hist) [8,248 bytes] HDelgadi (Talk | contribs) (Updating answers)
- 19:13, 19 September 2013 Individual hw week 4 (hist) [837 bytes] Mmalefyt (Talk | contribs) (Created page with "==Whole sequence== ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcggtcgcagagttggttacgctcattaccccgctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctcaccgctcccttatacgttgc...")
- 18:40, 19 September 2013 Lena Week 4 (hist) [1,968 bytes] Lena (Talk | contribs) (compiled some answers to week 4 questions)
- 19:18, 18 September 2013 Mpetredi Week 4 (hist) [2,768 bytes] Mpetredi (Talk | contribs) (Added some answers to Week 4 individual assignment. Need to check answers as well)
- 23:57, 17 September 2013 Kmeilak Week 4 (hist) [1,413 bytes] Kmeilak (Talk | contribs) (creation of assignment and input of results)
- 19:36, 17 September 2013 Class Journal Week 4 (hist) [13,464 bytes] Ajvree (Talk | contribs) (began class journal page)
- 17:20, 17 September 2013 Kevinmcgee Week 4 (hist) [1,560 bytes] Kevinmcgee (Talk | contribs) (Added some homework)
- 17:19, 17 September 2013 Laurmagee: Week 4 (hist) [3,839 bytes] Laurmagee (Talk | contribs) (Class Notes)
- 17:00, 17 September 2013 Ajvree Week 4 (hist) [2,323 bytes] Ajvree (Talk | contribs) (classnotes1)
- 16:40, 17 September 2013 Class Notes 2 (hist) [3,568 bytes] Mpetredi (Talk | contribs) (class notes 2 update)
- 16:39, 17 September 2013 Lena's Notes (hist) [569 bytes] Lena (Talk | contribs) (added notes from 9/17/13)
- 16:23, 17 September 2013 Ksherbina Week 4 (hist) [4,845 bytes] Ksherbina (Talk | contribs) (Added template.)
- 06:23, 16 September 2013 Kgosch Week 3 (hist) [403 bytes] Kgosch (Talk | contribs) (created page and added links)
- 14:22, 15 September 2013 Vkuehn Week 3 (hist) [2,266 bytes] Vkuehn (Talk | contribs) (Set up of page)
- 20:27, 14 September 2013 Command Line Crib Sheet (hist) [6,377 bytes] Dondi (Talk | contribs) (Start writing up reference-style “crib sheet.”)