User contributions
- 04:30, 20 October 2014 (diff | hist) . . (0) . . User:Gleis (→Gabriel Leis) (top)
- 04:30, 20 October 2014 (diff | hist) . . (0) . . User:Gleis (→Gabriel Leis)
- 04:29, 20 October 2014 (diff | hist) . . (0) . . User:Gleis (→Gabriel Leis)
- 04:29, 20 October 2014 (diff | hist) . . (0) . . User:Gleis (→Gabriel Leis)
- 04:28, 20 October 2014 (diff | hist) . . (0) . . User:Gleis (→Gabriel Leis)
- 04:27, 20 October 2014 (diff | hist) . . (0) . . User:Gleis (→Gabriel Leis)
- 04:26, 20 October 2014 (diff | hist) . . (0) . . User:Gleis (→Gabriel Leis)
- 04:23, 20 October 2014 (diff | hist) . . (-59) . . User:Gleis (→Gabriel Leis)
- 04:19, 20 October 2014 (diff | hist) . . (+10) . . User:Gleis (→Gabriel Leis)
- 04:18, 20 October 2014 (diff | hist) . . (+10) . . User:Gleis (→Gabriel Leis)
- 04:17, 20 October 2014 (diff | hist) . . (+136) . . User:Gleis (→Gabriel Leis)
- 04:14, 20 October 2014 (diff | hist) . . (+9) . . User:Gleis (→Gabriel Leis)
- 18:35, 12 December 2013 (diff | hist) . . (+55) . . Final Project Deliverables
- 18:35, 12 December 2013 (diff | hist) . . (0) . . N File:Leishmania Gene Database Testing Report.pdf (top)
- 18:22, 12 December 2013 (diff | hist) . . (-7) . . Leishmania major (→Visual Inspection)
- 18:22, 12 December 2013 (diff | hist) . . (+49) . . Leishmania major (→Coloring a MAPP with expression data)
- 18:21, 12 December 2013 (diff | hist) . . (+10) . . Leishmania major (→Running MAPPFinder)
- 18:20, 12 December 2013 (diff | hist) . . (+9) . . Leishmania major (→Putting a gene on the MAPP using the GeneFinder window)
- 18:17, 12 December 2013 (diff | hist) . . (-119) . . Final Project Deliverables
- 18:17, 12 December 2013 (diff | hist) . . (-25) . . Final Project Deliverables
- 18:15, 12 December 2013 (diff | hist) . . (0) . . N File:ReadMe Leishmania 20131212.pdf (top)
- 06:32, 12 December 2013 (diff | hist) . . (+43) . . Template:Leishmania Major File Updates
- 06:32, 12 December 2013 (diff | hist) . . (0) . . N File:ReadMe Leishmania 20131211.pdf (top)
- 06:26, 12 December 2013 (diff | hist) . . (+55) . . Template:Leishmania Major File Updates
- 06:24, 12 December 2013 (diff | hist) . . (0) . . N File:Leishmania schema 20101022.pdf (top)
- 02:51, 12 December 2013 (diff | hist) . . (-4) . . Leishmania major (→OriginalRowCounts Comparison)
- 02:50, 12 December 2013 (diff | hist) . . (+19) . . Leishmania major (→Putting a gene on the MAPP using the GeneFinder window)
- 02:49, 12 December 2013 (diff | hist) . . (+1) . . Leishmania major (→Running MAPPFinder)
- 02:49, 12 December 2013 (diff | hist) . . (+1) . . Leishmania major (→Coloring a MAPP with expression data)
- 02:49, 12 December 2013 (diff | hist) . . (+75) . . Leishmania major (→Creating an Expression Dataset in the Expression Dataset Manager)
- 01:09, 12 December 2013 (diff | hist) . . (+308) . . Gleis Week 15 (top)
- 01:06, 8 December 2013 (diff | hist) . . (+59) . . Template:Leishmania Major File Updates
- 01:05, 8 December 2013 (diff | hist) . . (0) . . N File:LeishmaniaGDB Lena Gabe 20131205.zip (top)
- 00:31, 8 December 2013 (diff | hist) . . (+91) . . Leishmania major (→.gdb Use in GenMAPP)
- 00:21, 8 December 2013 (diff | hist) . . (+110) . . Leishmania major (→.gdb Use in GenMAPP)
- 00:16, 8 December 2013 (diff | hist) . . (-46) . . Leishmania major (→Visual Inspection)
- 00:15, 8 December 2013 (diff | hist) . . (+145) . . Leishmania major (→Visual Inspection)
- 00:12, 8 December 2013 (diff | hist) . . (0) . . Leishmania major (→OriginalRowCounts Comparison)
- 00:11, 8 December 2013 (diff | hist) . . (0) . . N File:Leishmania OrginialRowCounts 07122013.PNG (top)
- 06:26, 7 December 2013 (diff | hist) . . (+58) . . Gleis Week 15 (→Lab Journal)
- 06:25, 7 December 2013 (diff | hist) . . (+22) . . Gleis Week 15 (→Lab Journal)
- 06:24, 7 December 2013 (diff | hist) . . (+77) . . Gleis Week 15 (→Lab Journal)
- 06:23, 7 December 2013 (diff | hist) . . (+178) . . Gleis Week 15 (→Lab Journal)
- 06:19, 7 December 2013 (diff | hist) . . (+78) . . Leishmania major Week 15 Status Report (→Status report as to progress on each milestone that that you have set for the week:)
- 06:17, 7 December 2013 (diff | hist) . . (+6) . . Leishmania major Week 15 Status Report (→Reflection)
- 06:16, 7 December 2013 (diff | hist) . . (+78) . . Leishmania major Week 15 Status Report (→Reflection)
- 03:25, 7 December 2013 (diff | hist) . . (+376) . . Leishmania major Week 15 Status Report (→Reflection)
- 05:28, 4 December 2013 (diff | hist) . . (+50) . . Leishmania major (→Data Files)
- 05:27, 4 December 2013 (diff | hist) . . (0) . . N File:Dist Leishmania Lena Gabe 03122013.zip (top)
- 18:50, 3 December 2013 (diff | hist) . . (+146) . . N Gleis Week 15 (Created page with "==Lab Journal== *Code needed ID changes in Eclipse *Replaced first period with an "_" and removed second "_" *Replaced to look like "LMJF_##_####"")
- 18:48, 3 December 2013 (diff | hist) . . (+19) . . Template:Workstuff (top)
- 22:31, 26 November 2013 (diff | hist) . . (+118) . . Gleis Week 14 (→Status Report) (top)
- 22:31, 26 November 2013 (diff | hist) . . (0) . . N File:Leishmania Data import error.PNG (top)
- 22:06, 26 November 2013 (diff | hist) . . (+48) . . Leishmania major (→Data Files)
- 22:05, 26 November 2013 (diff | hist) . . (+47) . . N File:LeishmaniaGDB 26112013 Lena Gabe.gdb (Newly exported GBD with proper tables in Access) (top)
- 22:04, 26 November 2013 (diff | hist) . . (+89) . . Gleis Week 14 (→Status Report)
- 21:57, 26 November 2013 (diff | hist) . . (+42) . . Gleis Week 14 (→Status Report)
- 21:57, 26 November 2013 (diff | hist) . . (+122) . . Gleis Week 14 (→Status Report)
- 21:56, 26 November 2013 (diff | hist) . . (0) . . N File:Leishmania GDBexport complete 26112013.PNG (top)
- 21:53, 26 November 2013 (diff | hist) . . (+127) . . Gleis Week 14 (→Status Report)
- 21:53, 26 November 2013 (diff | hist) . . (0) . . N File:Leishmania GDBexport status 67percent.PNG (top)
- 21:50, 26 November 2013 (diff | hist) . . (-44) . . Template:Leishmania Major Navigation (→Leishmania Major Helpful Links) (top)
- 20:18, 26 November 2013 (diff | hist) . . (+217) . . Gleis Week 14
- 20:14, 26 November 2013 (diff | hist) . . (0) . . N File:SQL Query ResultsandIDPattern Leishmania.PNG (top)
- 19:51, 26 November 2013 (diff | hist) . . (0) . . File:Leishmania database 26112013 Gmbuilder-32bit.zip (Gleis uploaded a new version of "File:Leishmania database 26112013 Gmbuilder-32bit.zip": Include whole folder now instead of just .bat) (top)
- 19:46, 26 November 2013 (diff | hist) . . (+60) . . Leishmania major (→Data Files)
- 19:44, 26 November 2013 (diff | hist) . . (0) . . N File:Leishmania database 26112013 Gmbuilder-32bit.zip
- 19:22, 26 November 2013 (diff | hist) . . (+44) . . Template:Leishmania Major Navigation (→Leishmania Major Helpful Links)
- 19:13, 26 November 2013 (diff | hist) . . (+124) . . N Gleis Week 14 (Created page with "==To Do List== *Identify new URL pattern *Fix import/export issues *Fix ID code *Tally Engine code not showing Ordered Locus")
- 19:12, 26 November 2013 (diff | hist) . . (+19) . . Template:Workstuff
- 19:04, 26 November 2013 (diff | hist) . . (0) . . File:LeishmaniaGDB 21112013 Lena Gabe.gdb (Gleis uploaded a new version of "File:LeishmaniaGDB 21112013 Lena Gabe.gdb") (top)
- 19:03, 26 November 2013 (diff | hist) . . (+47) . . User:Gleis
- 19:02, 26 November 2013 (diff | hist) . . (+47) . . User:Gleis
- 18:46, 26 November 2013 (diff | hist) . . (0) . . N File:Commandline leishmania.png (top)
- 18:45, 26 November 2013 (diff | hist) . . (+39) . . Lena Project Notebook (→XMLpipedb Match)
- 18:44, 26 November 2013 (diff | hist) . . (+1) . . Lena Project Notebook (→XMLpipedb Match)
- 18:43, 26 November 2013 (diff | hist) . . (+7) . . Lena Project Notebook (→XMLpipedb Match)
- 18:43, 26 November 2013 (diff | hist) . . (-5) . . Lena Project Notebook (→XMLpipedb Match)
- 18:43, 26 November 2013 (diff | hist) . . (0) . . N File:Leishmania Postgres Query ORF 26112013 1.PNG (top)
- 18:42, 26 November 2013 (diff | hist) . . (+7) . . Lena Project Notebook (→XMLpipedb Match)
- 18:42, 26 November 2013 (diff | hist) . . (+48) . . Lena Project Notebook (→XMLpipedb Match)
- 18:41, 26 November 2013 (diff | hist) . . (0) . . N File:Leishmania Postgres Query ORF 26112013.PNG (top)
- 17:59, 26 November 2013 (diff | hist) . . (+48) . . Leishmania major (→Data Files)
- 17:58, 26 November 2013 (diff | hist) . . (0) . . N File:Leishmania Tallyresults 11262013.PNG (top)
- 05:30, 22 November 2013 (diff | hist) . . (+137) . . Leishmania major Week 13 Status Report (top)
- 05:28, 22 November 2013 (diff | hist) . . (+207) . . Leishmania major Week 13 Status Report (→Gabriel Leis)
- 05:26, 22 November 2013 (diff | hist) . . (+184) . . Leishmania major Week 13 Status Report (→Gabriel Leis)
- 18:44, 21 November 2013 (diff | hist) . . (+48) . . Leishmania major (→Data Files)
- 18:44, 21 November 2013 (diff | hist) . . (0) . . N File:LeishmaniaGDB 21112013 Lena Gabe.gdb
- 18:39, 21 November 2013 (diff | hist) . . (+123) . . Leishmania major Week 13 Status Report (→Reflections)
- 18:35, 21 November 2013 (diff | hist) . . (+3) . . Gleis Week 13 (→Lab Journal) (top)
- 18:32, 21 November 2013 (diff | hist) . . (+79) . . Gleis Week 13
- 18:31, 21 November 2013 (diff | hist) . . (-17) . . Gleis Week 13
- 18:30, 21 November 2013 (diff | hist) . . (+72) . . Gleis Week 13
- 18:25, 21 November 2013 (diff | hist) . . (+158) . . Gleis Week 13
- 18:23, 21 November 2013 (diff | hist) . . (+48) . . Leishmania major (→Data Files)
- 18:22, 21 November 2013 (diff | hist) . . (0) . . N File:L.majorCompiledRawData C 21112013.txt (top)
- 18:22, 21 November 2013 (diff | hist) . . (+70) . . Gleis Week 13 (→Lab Journal)
- 18:41, 19 November 2013 (diff | hist) . . (+12) . . Leishmania major Week 13 Status Report (→Export Information)
- 18:35, 19 November 2013 (diff | hist) . . (+13) . . Leishmania major Week 13 Status Report (→Export Information)
- 18:34, 19 November 2013 (diff | hist) . . (+45) . . Gleis Week 13 (→Lab Journal)
- 18:29, 19 November 2013 (diff | hist) . . (+50) . . Gleis Week 13 (→Lab Journal)
- 18:28, 19 November 2013 (diff | hist) . . (+228) . . N Gleis Week 13 (Created page with "==Lab Journal== *Identified database link pattern: :*http://www.genedb.org/gene/~ *Customized species profile :*Linked Ordered Locus Names to ORF :*Updated Species Database Li...")
- 18:24, 19 November 2013 (diff | hist) . . (+12) . . Leishmania major Week 13 Status Report (→Export Information)
- 18:21, 19 November 2013 (diff | hist) . . (+32) . . Template:Workstuff
- 18:20, 19 November 2013 (diff | hist) . . (+147) . . Leishmania major Week 13 Status Report (→Export Information)
- 18:18, 19 November 2013 (diff | hist) . . (+173) . . N Leishmania major Week 13 Status Report (Created page with "==Import/Export GenMAPP== Name:Leishmania_major_18112013 ===Export Information=== :Uniprot: : :GO OBO: : :GOA: : ===Tally Engine=== ===Original Row Counts Comparison===")
- 18:11, 19 November 2013 (diff | hist) . . (+45) . . Leishmania major (→Data Files)
- 18:10, 19 November 2013 (diff | hist) . . (0) . . N File:Leishmania major 19112013 Dist.zip
- 19:58, 14 November 2013 (diff | hist) . . (+58) . . Gleis Week 12 (top)
- 19:57, 14 November 2013 (diff | hist) . . (+21) . . The Plan (→Timeline)
- 19:56, 14 November 2013 (diff | hist) . . (0) . . Gleis Week 12
- 19:55, 14 November 2013 (diff | hist) . . (+36) . . Gleis Week 12
- 19:54, 14 November 2013 (diff | hist) . . (+79) . . Gleis Week 12
- 19:53, 14 November 2013 (diff | hist) . . (+35) . . Leishmania major Week 12 Status Report (top)
- 19:52, 14 November 2013 (diff | hist) . . (+962) . . Leishmania major Week 12 Status Report
- 19:41, 14 November 2013 (diff | hist) . . (+36) . . Template:Workstuff
- 19:39, 14 November 2013 (diff | hist) . . (+76) . . Gleis Week 12
- 19:38, 14 November 2013 (diff | hist) . . (+545) . . Gleis Week 12
- 19:33, 14 November 2013 (diff | hist) . . (+218) . . Gleis Week 12 (→Lab Journal)
- 19:17, 14 November 2013 (diff | hist) . . (+26) . . Template:Workstuff
- 19:15, 14 November 2013 (diff | hist) . . (+50) . . Gleis Week 12
- 19:08, 14 November 2013 (diff | hist) . . (+1) . . Gleis Week 12 (→Lab Journal)
- 19:06, 14 November 2013 (diff | hist) . . (+52) . . Gleis Week 12 (→Lab Journal)
- 19:05, 14 November 2013 (diff | hist) . . (0) . . N File:Eclipse customs Gleis 14112013.PNG (top)
- 19:01, 14 November 2013 (diff | hist) . . (+17) . . Gleis Week 12
- 18:30, 14 November 2013 (diff | hist) . . (+27) . . Gleis Week 12
- 18:28, 14 November 2013 (diff | hist) . . (+57) . . Gleis Week 12
- 18:16, 14 November 2013 (diff | hist) . . (+65) . . Gleis Week 12
- 18:07, 14 November 2013 (diff | hist) . . (+8) . . Gleis Week 12
- 17:48, 14 November 2013 (diff | hist) . . (+53) . . N Gleis Week 12 (Created page with "Eclipse>workbench>+canister>follow coder instructions")
- 17:40, 14 November 2013 (diff | hist) . . (+19) . . Template:Workstuff
- 07:00, 12 November 2013 (diff | hist) . . (+120) . . Gleis Week 11 (top)
- 06:08, 12 November 2013 (diff | hist) . . (+49) . . Gleis Week 11
- 06:07, 12 November 2013 (diff | hist) . . (+30) . . Gleis Week 11
- 06:07, 12 November 2013 (diff | hist) . . (+22) . . Gleis Week 11
- 08:01, 11 November 2013 (diff | hist) . . (+235) . . Gleis Week 11
- 07:52, 11 November 2013 (diff | hist) . . (+226) . . Gleis Week 11
- 07:47, 11 November 2013 (diff | hist) . . (+500) . . Gleis Week 11
- 03:50, 11 November 2013 (diff | hist) . . (+30) . . Gleis Week 11
- 01:22, 11 November 2013 (diff | hist) . . (+948) . . Gleis Week 11
- 01:07, 11 November 2013 (diff | hist) . . (+548) . . Gleis Week 11
- 00:55, 11 November 2013 (diff | hist) . . (+524) . . Gleis Week 11
- 00:35, 11 November 2013 (diff | hist) . . (+761) . . Gleis Week 11
- 00:23, 11 November 2013 (diff | hist) . . (+1,475) . . Gleis Week 11
- 22:53, 10 November 2013 (diff | hist) . . (+519) . . Gleis Week 11 (→III. Genome structure and content)
- 01:32, 10 November 2013 (diff | hist) . . (+861) . . Gleis Week 11
- 00:55, 10 November 2013 (diff | hist) . . (+32) . . Gleis Week 11
- 00:54, 10 November 2013 (diff | hist) . . (+60) . . Gleis Week 11 (→GO Terms)
- 00:53, 10 November 2013 (diff | hist) . . (+1,992) . . Gleis Week 11 (→GO Terms)
- 19:55, 7 November 2013 (diff | hist) . . (+9) . . Gleis Week 11 (→GO Terms)
- 19:55, 7 November 2013 (diff | hist) . . (+142) . . Gleis Week 11 (→GO Terms)
- 18:41, 7 November 2013 (diff | hist) . . (+44) . . Leishmania major (→Data Files)
- 18:41, 7 November 2013 (diff | hist) . . (0) . . N File:Leishmania 05112013 Lena Gabe.gdb (top)
- 18:40, 7 November 2013 (diff | hist) . . (+84) . . Leishmania major (→Data Files)
- 18:39, 7 November 2013 (diff | hist) . . (0) . . N File:Tally Results Leishmania OBO.PNG (top)
- 18:38, 7 November 2013 (diff | hist) . . (0) . . N File:Tally Results Leishmania.PNG (top)
- 18:38, 7 November 2013 (diff | hist) . . (+51) . . Leishmania major (→Data Files)
- 18:36, 7 November 2013 (diff | hist) . . (0) . . N File:Leishmania 05112013 Gabe Lena.obo-xml.gz (top)
- 17:49, 7 November 2013 (diff | hist) . . (+12) . . N Gleis Week 11 (Created page with "==GO Terms==")
- 17:49, 7 November 2013 (diff | hist) . . (+32) . . Template:Workstuff
- 19:51, 5 November 2013 (diff | hist) . . (+19) . . Leishmania major (→Group Projects)
- 19:19, 5 November 2013 (diff | hist) . . (+38) . . Leishmania major (→Group Projects)
- 19:16, 5 November 2013 (diff | hist) . . (+1) . . Leishmania major (→Data Files)
- 19:13, 5 November 2013 (diff | hist) . . (+53) . . Leishmania major (→Data Files)
- 19:12, 5 November 2013 (diff | hist) . . (0) . . N File:UniprotXML Leishmania 05112013 Gabe Lena.xml (top)
- 18:30, 5 November 2013 (diff | hist) . . (0) . . Leishmania major (→Reference Genome Article)
- 18:29, 5 November 2013 (diff | hist) . . (-6) . . Leishmania major (→Reference Genome Article)
- 18:28, 5 November 2013 (diff | hist) . . (+1,629) . . Leishmania major (→Reference Genome Article)
- 18:00, 5 November 2013 (diff | hist) . . (-30) . . Leishmania major (→Reference Genome Article)
- 18:00, 5 November 2013 (diff | hist) . . (-1) . . Leishmania major (→Reference Genome Article)
- 17:59, 5 November 2013 (diff | hist) . . (-7) . . Leishmania major (→Reference Genome Article)
- 17:56, 5 November 2013 (diff | hist) . . (+1) . . Leishmania Major Articles
- 17:52, 5 November 2013 (diff | hist) . . (-9) . . Leishmania Major Articles
- 17:52, 5 November 2013 (diff | hist) . . (-1) . . Leishmania Major Articles
- 17:51, 5 November 2013 (diff | hist) . . (+9) . . Leishmania Major Articles
- 17:42, 5 November 2013 (diff | hist) . . (+8) . . Leishmania major
- 00:27, 2 November 2013 (diff | hist) . . (+553) . . Gleis Week 10 (top)
- 00:19, 2 November 2013 (diff | hist) . . (+269) . . Leishmania Major Articles (→Microarray Articles)
- 00:09, 2 November 2013 (diff | hist) . . (+198) . . Leishmania Major Articles (→Microarray Articles)
- 00:06, 2 November 2013 (diff | hist) . . (0) . . N File:Comparative-expression-profile GLeis 20131031.pdf (top)
- 23:35, 31 October 2013 (diff | hist) . . (+298) . . Leishmania Major Articles (→Microarray Articles)
- 23:20, 31 October 2013 (diff | hist) . . (+71) . . Leishmania Major Articles
- 17:16, 31 October 2013 (diff | hist) . . (+93) . . Gleis Week 10
- 16:45, 31 October 2013 (diff | hist) . . (+2) . . Leishmania major
- 16:37, 31 October 2013 (diff | hist) . . (+16) . . Leishmania major
- 18:36, 29 October 2013 (diff | hist) . . (+58) . . Leishmania major (→Microarray Articles)
- 18:06, 29 October 2013 (diff | hist) . . (+96) . . Gleis Week 10 (→Lab Journal)
- 17:42, 29 October 2013 (diff | hist) . . (+187) . . Gleis Week 10
- 17:42, 29 October 2013 (diff | hist) . . (0) . . N File:Screen shot Leishmania Genomes GLeis.png (top)
- 17:34, 29 October 2013 (diff | hist) . . (+47) . . Gleis Week 10
- 17:22, 29 October 2013 (diff | hist) . . (+77) . . Gleis Week 10
- 17:21, 29 October 2013 (diff | hist) . . (0) . . N File:Sreen-shot microarray search Gleis 20131029.png (top)
- 17:14, 29 October 2013 (diff | hist) . . (+4) . . Gleis Week 10
- 17:03, 29 October 2013 (diff | hist) . . (+252) . . N Gleis Week 10 (Created page with "==Lab Journal== *Opened Week 10 assignment page *Followed this link, http://libguides.lmu.edu/BIOL367 to the lib guide home page *opened pub med browser *Used the advanced...")
- 17:00, 29 October 2013 (diff | hist) . . (+19) . . Template:Workstuff
- 23:54, 24 October 2013 (diff | hist) . . (+555) . . Gleis Week 9 (top)
- 21:39, 24 October 2013 (diff | hist) . . (+801) . . Class Journal Week 9
- 21:17, 24 October 2013 (diff | hist) . . (+51) . . Template:Workstuff
- 21:14, 24 October 2013 (diff | hist) . . (+13) . . Gleis Week 9
- 21:13, 24 October 2013 (diff | hist) . . (+15) . . Gleis Week 9
- 19:20, 24 October 2013 (diff | hist) . . (+103) . . Gleis Week 9 (→.gdb Use in GenMAPP)
- 18:44, 24 October 2013 (diff | hist) . . (+13) . . Gleis Week 9 (→OriginalRowCounts Comparison)
- 18:44, 24 October 2013 (diff | hist) . . (+9) . . Gleis Week 9 (→Export Information)
- 18:43, 24 October 2013 (diff | hist) . . (0) . . File:Vc-Std 20131022-GLeis-gmb2b70.gdb (Gleis uploaded a new version of "File:Vc-Std 20131022-GLeis-gmb2b70.gdb") (top)
- 18:42, 24 October 2013 (diff | hist) . . (+9) . . Gleis Week 9 (→Export Information)
- 18:42, 24 October 2013 (diff | hist) . . (0) . . N File:46.V cholerae ATCC 39315 Gleis 10 22.goa (top)
- 18:41, 24 October 2013 (diff | hist) . . (+13) . . Gleis Week 9 (→Export Information)
- 18:40, 24 October 2013 (diff | hist) . . (0) . . N File:Go daily-termdb.obo-xml GLEIS 20131022.gz (top)
- 18:38, 24 October 2013 (diff | hist) . . (+10) . . Gleis Week 9 (→Export Information)
- 18:37, 24 October 2013 (diff | hist) . . (0) . . N File:VC Uniprot GLeis 10 22.xml (top)
- 18:36, 24 October 2013 (diff | hist) . . (+11) . . Gleis Week 9 (→Export Information)
- 18:35, 24 October 2013 (diff | hist) . . (0) . . N File:Access-RowCounts Gleis.PNG (top)
- 18:34, 24 October 2013 (diff | hist) . . (+52) . . Gleis Week 9 (→Visual Inspection)
- 18:29, 24 October 2013 (diff | hist) . . (+44) . . Gleis Week 9 (→Visual Inspection)
- 18:27, 24 October 2013 (diff | hist) . . (+30) . . Gleis Week 9 (→OriginalRowCounts Comparison)
- 18:26, 24 October 2013 (diff | hist) . . (+1) . . Gleis Week 9 (→OriginalRowCounts Comparison)
- 18:26, 24 October 2013 (diff | hist) . . (+703) . . Gleis Week 9 (→OriginalRowCounts Comparison)
- 18:24, 24 October 2013 (diff | hist) . . (+115) . . Gleis Week 9 (→Using SQL Queries to Validate the PostgreSQL Database Results from the TallyEngine)
- 18:24, 24 October 2013 (diff | hist) . . (0) . . N File:SQL-count-GLEIS.PNG (top)
- 18:23, 24 October 2013 (diff | hist) . . (+138) . . Gleis Week 9 (→Using XMLPipeDB match to Validate the XML Results from the TallyEngine)
- 18:21, 24 October 2013 (diff | hist) . . (0) . . N File:Xmlpipedbmatch Results Gleis.PNG (top)
- 18:14, 24 October 2013 (diff | hist) . . (+44) . . Gleis Week 9 (→TallyEngine)
- 18:13, 24 October 2013 (diff | hist) . . (0) . . N File:Tally-results-Gleis-20131024.PNG (top)
- 18:10, 24 October 2013 (diff | hist) . . (-3) . . Gleis Week 9 (→Export Information)
- 17:56, 24 October 2013 (diff | hist) . . (+41) . . N Leishmania major (Created page with "='''Team 3'''= =='''Leishmania Major'''==")
- 17:55, 24 October 2013 (diff | hist) . . (0) . . Main Page (→Teams)
- 17:54, 24 October 2013 (diff | hist) . . (-6) . . ''Leishmania major'' (top)
- 17:54, 24 October 2013 (diff | hist) . . (+16) . . N ''Leishmania major'' (Created page with "Leishmania major")
- 17:52, 24 October 2013 (diff | hist) . . (+2) . . Main Page
- 17:51, 24 October 2013 (diff | hist) . . (+16) . . N Placeholder Team 3 (Created page with "Leishmania major") (top)
- 17:43, 24 October 2013 (diff | hist) . . (+8) . . Gleis Week 9 (→Export Information)
- 17:43, 24 October 2013 (diff | hist) . . (+5) . . Gleis Week 9 (→Export Information)
- 17:42, 24 October 2013 (diff | hist) . . (+43) . . Gleis Week 9
- 17:05, 24 October 2013 (diff | hist) . . (+25) . . N File:Vc-Std 20131022-GLeis-gmb2b70.gdb (Gene Database File Week 9)
- 23:49, 23 October 2013 (diff | hist) . . (+184) . . Gleis Week 9
- 23:46, 23 October 2013 (diff | hist) . . (+468) . . Gleis Week 9
- 23:37, 23 October 2013 (diff | hist) . . (+301) . . Gleis Week 9 (→Lab Journal)
- 23:25, 23 October 2013 (diff | hist) . . (+232) . . Gleis Week 9
- 23:22, 23 October 2013 (diff | hist) . . (+48) . . Gleis Week 9 (→Lab Journal)
- 17:31, 22 October 2013 (diff | hist) . . (+116) . . Gleis Week 9 (→Lab Journal)
- 17:23, 22 October 2013 (diff | hist) . . (+12) . . Gleis Week 9 (→Export Information)
- 17:19, 22 October 2013 (diff | hist) . . (+182) . . Gleis Week 9 (started Journal)
- 17:07, 22 October 2013 (diff | hist) . . (+25) . . Gleis Week 9
- 17:01, 22 October 2013 (diff | hist) . . (+55) . . Gleis Week 9 (→Export Information)
- 16:58, 22 October 2013 (diff | hist) . . (+41) . . Gleis Week 9
- 16:56, 22 October 2013 (diff | hist) . . (+40) . . Gleis Week 9 (→Export Information)
- 16:53, 22 October 2013 (diff | hist) . . (+26) . . Gleis Week 9 (→Export Information)
- 16:40, 22 October 2013 (diff | hist) . . (+4,055) . . N Gleis Week 9 (Template)
- 16:40, 22 October 2013 (diff | hist) . . (+18) . . Template:Workstuff
- 23:44, 20 October 2013 (diff | hist) . . (+48) . . Class Journal Week 8 (addition of categories to page)
- 23:43, 20 October 2013 (diff | hist) . . (+1,854) . . Class Journal Week 8
- 08:08, 18 October 2013 (diff | hist) . . (+768) . . Gleis Week 8 (top)
- 08:08, 18 October 2013 (diff | hist) . . (0) . . N File:Gleis - Merrell Compiled Raw Data Vibrio.gmf (top)
- 07:55, 18 October 2013 (diff | hist) . . (0) . . N File:Decreased Expression Vibrio Gleis-Criterion1-GO-Criterion0-GO.xls (top)
- 07:42, 18 October 2013 (diff | hist) . . (+479) . . Gleis Week 8
- 07:32, 18 October 2013 (diff | hist) . . (+13) . . Gleis Week 8
- 07:31, 18 October 2013 (diff | hist) . . (0) . . N File:Decreased Expression Vibrio Gleis-Criterion1-GO-Criterion0-GO.txt (top)
- 07:21, 18 October 2013 (diff | hist) . . (+5) . . Gleis Week 8
- 07:20, 18 October 2013 (diff | hist) . . (+107) . . Gleis Week 8
- 07:19, 18 October 2013 (diff | hist) . . (+578) . . Gleis Week 8 (→Lab Journal part 2)
- 07:17, 18 October 2013 (diff | hist) . . (0) . . N File:Outer membrane-bounded periplasmic space.mapp (top)
- 07:02, 18 October 2013 (diff | hist) . . (+59) . . Gleis Week 8 (→Lab Journal part 2)
- 07:01, 18 October 2013 (diff | hist) . . (+1,815) . . Gleis Week 8
- 05:46, 18 October 2013 (diff | hist) . . (+54) . . Gleis Week 8
- 05:45, 18 October 2013 (diff | hist) . . (+2) . . Gleis Week 8 (→Lab Journal part 2)
- 05:44, 18 October 2013 (diff | hist) . . (+111) . . Gleis Week 8
- 05:43, 18 October 2013 (diff | hist) . . (0) . . N File:Gleis - Merrell Compiled Raw Data Vibrio.gex (top)
- 05:42, 18 October 2013 (diff | hist) . . (+2) . . Gleis Week 8 (→Relevant Files)
- 05:42, 18 October 2013 (diff | hist) . . (+201) . . Gleis Week 8 (→Lab Journal part 2)
- 05:41, 18 October 2013 (diff | hist) . . (+13) . . N File:Gleis - Merrell Compiled Raw Data Vibrio.EX.txt (Gleis version) (top)
- 05:35, 18 October 2013 (diff | hist) . . (+18) . . N File:Deacreased Expression Vibrio Gleis-Criterion1-GO.xls (GenMAPP excel file) (top)
- 05:33, 18 October 2013 (diff | hist) . . (+68) . . Gleis Week 8 (→Lab Journal part 2)
- 05:29, 18 October 2013 (diff | hist) . . (-383) . . Gleis Week 8 (→Lab Journal part 2)
- 05:18, 18 October 2013 (diff | hist) . . (+187) . . Gleis Week 8 (→Lab Journal part 2: continued lab journal)
- 05:13, 18 October 2013 (diff | hist) . . (+877) . . Gleis Week 8 (→Lab Journal part 2)
- 04:53, 18 October 2013 (diff | hist) . . (+425) . . Gleis Week 8 (continued lab journal)
- 04:42, 18 October 2013 (diff | hist) . . (+1,015) . . Gleis Week 8 (→Lab Journal part 2: continued lab journal)
- 00:34, 18 October 2013 (diff | hist) . . (+287) . . Gleis Week 8 (→Lab Journal part 2: resumed lab journal)
- 17:44, 17 October 2013 (diff | hist) . . (+42) . . Gleis Week 8 (→Lab Journal part 2=)
- 17:35, 17 October 2013 (diff | hist) . . (+345) . . Gleis Week 8 (Added top 10 GO terms)
- 17:07, 17 October 2013 (diff | hist) . . (+5,562) . . Gleis Week 8 (Added gene IDs for genes with error)
- 17:06, 17 October 2013 (diff | hist) . . (+135) . . Gleis Week 8 (Begin lab journal part 2)
- 17:41, 15 October 2013 (diff | hist) . . (0) . . N File:Deacreased Expression Vibrio Gleis-Criterion1-GO.txt (top)
- 03:20, 15 October 2013 (diff | hist) . . (0) . . File:Merrell Compiled Raw Data Vibrio Gleis forGenMAPP.xls (Gleis uploaded a new version of "File:Merrell Compiled Raw Data Vibrio Gleis forGenMAPP.xls") (top)
- 02:53, 15 October 2013 (diff | hist) . . (0) . . Gleis Week 8 (→Uploaded Files)
- 02:53, 15 October 2013 (diff | hist) . . (+28) . . Gleis Week 8 (→Uploaded Files)
- 02:52, 15 October 2013 (diff | hist) . . (0) . . N File:Merrell Compiled Raw Data Vibrio Gleis forGenMAPP.xls
- 02:52, 15 October 2013 (diff | hist) . . (+28) . . Gleis Week 8 (→Uploaded Files)
- 02:50, 15 October 2013 (diff | hist) . . (+27) . . N File:Merrell Compiled Raw Data Vibrio Gleis forGenMAPP.txt (New Version of old document) (top)
- 05:41, 11 October 2013 (diff | hist) . . (+10) . . Gleis Week 8 (→Lab Journal)
- 05:41, 11 October 2013 (diff | hist) . . (+1,585) . . Gleis Week 8
- 05:19, 11 October 2013 (diff | hist) . . (+134) . . Gleis Week 8
- 05:02, 11 October 2013 (diff | hist) . . (+37) . . Gleis Week 8
- 05:00, 11 October 2013 (diff | hist) . . (+33) . . Gleis Week 8
- 04:43, 11 October 2013 (diff | hist) . . (+98) . . Gleis Week 8
- 04:40, 11 October 2013 (diff | hist) . . (+24) . . N File:ForGenMapp Gleis 10-10.xls (The VC for genmapp Excel) (top)
- 04:38, 11 October 2013 (diff | hist) . . (+28) . . N File:ForGenMapp Gleis 10-10.txt (Gen Mapp Excel in txt format) (top)
- 04:35, 11 October 2013 (diff | hist) . . (+40) . . N Gleis Week 8 (Created page with "==Vibrio cholerae statistical analysis==")
- 04:33, 11 October 2013 (diff | hist) . . (+57) . . Template:Workstuff
- 04:06, 10 October 2013 (diff | hist) . . (+6) . . Class Journal Week 7
- 04:05, 10 October 2013 (diff | hist) . . (+42) . . Class Journal Week 7
- 04:05, 10 October 2013 (diff | hist) . . (+798) . . Class Journal Week 7
- 02:28, 10 October 2013 (diff | hist) . . (+28) . . Gleis Week 7 (top)
- 02:27, 10 October 2013 (diff | hist) . . (+77) . . Gleis Week 7
- 02:27, 10 October 2013 (diff | hist) . . (+1,089) . . Gleis Week 7
- 01:03, 10 October 2013 (diff | hist) . . (+132) . . Gleis Week 7
- 00:58, 10 October 2013 (diff | hist) . . (+794) . . Gleis Week 7 (Answers 6-10)
- 00:48, 10 October 2013 (diff | hist) . . (+193) . . Gleis Week 7
- 00:24, 10 October 2013 (diff | hist) . . (+44) . . Gleis Week 7
- 00:24, 10 October 2013 (diff | hist) . . (+64) . . N Gleis Week 7 (Created page with "==Introduction to MicroArrays== 5. image:Mrna-expression.jpg")
- 00:23, 10 October 2013 (diff | hist) . . (0) . . N File:Mrna-expression.jpg (top)
- 00:18, 10 October 2013 (diff | hist) . . (+76) . . Gleis Week 5 (top)
- 00:18, 10 October 2013 (diff | hist) . . (+28) . . Gleis Week 5 (added category)
- 23:45, 9 October 2013 (diff | hist) . . (+56) . . Template:Workstuff
- 05:21, 4 October 2013 (diff | hist) . . (+1,543) . . Class Journal Week 5 (→Gabriel Leis: Response to Reflect Questions)
- 05:04, 4 October 2013 (diff | hist) . . (+28) . . Gleis Week 6 (top)
- 05:03, 4 October 2013 (diff | hist) . . (+77) . . Gleis Week 6
- 05:02, 4 October 2013 (diff | hist) . . (+48) . . Class Journal Week 6
- 04:59, 4 October 2013 (diff | hist) . . (+2,235) . . Class Journal Week 6
- 04:09, 4 October 2013 (diff | hist) . . (+274) . . Gleis Week 6
- 03:55, 4 October 2013 (diff | hist) . . (+2) . . Gleis Week 6
- 03:54, 4 October 2013 (diff | hist) . . (+122) . . Gleis Week 6
- 03:33, 4 October 2013 (diff | hist) . . (+141) . . Gleis Week 6
- 03:26, 4 October 2013 (diff | hist) . . (+10) . . Gleis Week 6
- 03:25, 4 October 2013 (diff | hist) . . (+1,295) . . Gleis Week 6
- 03:16, 4 October 2013 (diff | hist) . . (+259) . . Gleis Week 6
- 19:32, 3 October 2013 (diff | hist) . . (+196) . . Gleis Week 6
- 19:24, 3 October 2013 (diff | hist) . . (+55) . . Gleis Week 6
- 19:20, 3 October 2013 (diff | hist) . . (+449) . . Gleis Week 6
- 19:17, 3 October 2013 (diff | hist) . . (+502) . . Gleis Week 6
- 18:57, 3 October 2013 (diff | hist) . . (+157) . . Gleis Week 6
- 18:55, 3 October 2013 (diff | hist) . . (+37) . . N Gleis Week 6 (Created page with "==Movies from Text File to Tables== #")
- 18:54, 3 October 2013 (diff | hist) . . (+55) . . Template:Workstuff
- 03:15, 3 October 2013 (diff | hist) . . (+49) . . PrePPI (edited answers #5 and #6)
- 03:10, 30 September 2013 (diff | hist) . . (+4) . . PrePPI (→Information Regarding the Database)
- 02:55, 30 September 2013 (diff | hist) . . (+1) . . PrePPI (→Information Regarding the Database)
- 02:55, 30 September 2013 (diff | hist) . . (-64) . . m PrePPI (→Information Regarding the Database: edited species)
- 02:53, 30 September 2013 (diff | hist) . . (+1) . . m PrePPI
- 02:40, 30 September 2013 (diff | hist) . . (+627) . . PrePPI (Added user friendliness section to database wiki)
- 22:56, 29 September 2013 (diff | hist) . . (+120) . . PrePPI (→Information Regarding the Database: added links)
- 22:45, 29 September 2013 (diff | hist) . . (+1,046) . . PrePPI (→Information Regarding the Database: Preliminary answers)
- 19:17, 26 September 2013 (diff | hist) . . (+635) . . Gleis Week 5 (Answered questions)
- 02:50, 25 September 2013 (diff | hist) . . (+111) . . Gleis Week 5 (finished summary)
- 02:47, 25 September 2013 (diff | hist) . . (+59) . . Gleis Week 5 (→Summary)
- 02:43, 25 September 2013 (diff | hist) . . (+487) . . Gleis Week 5 (started summary)
- 02:25, 25 September 2013 (diff | hist) . . (+181) . . Gleis Week 5 (added final steps)
- 02:23, 25 September 2013 (diff | hist) . . (+87) . . Gleis Week 5 (Included next step)
- 00:21, 25 September 2013 (diff | hist) . . (+70) . . N Gleis Week 5 (Created page with "==E-Notebook== :*Obtained copy of Bioinformatics for Dummies Chapter 4")
- 00:20, 25 September 2013 (diff | hist) . . (+56) . . Template:Workstuff
- 04:26, 20 September 2013 (diff | hist) . . (+48) . . Gleis Week 4 (top)
- 04:25, 20 September 2013 (diff | hist) . . (+32) . . Gleis Week 4 (added signature)
- 04:24, 20 September 2013 (diff | hist) . . (+28) . . Gleis Week 4 (added category)
- 04:24, 20 September 2013 (diff | hist) . . (+12) . . Template:Workstuff (added link)
- 04:22, 20 September 2013 (diff | hist) . . (+26) . . Template:Workstuff (added link to journal)
- 04:21, 20 September 2013 (diff | hist) . . (+48) . . Class Journal Week 4
- 04:20, 20 September 2013 (diff | hist) . . (+677) . . Class Journal Week 4
- 04:12, 20 September 2013 (diff | hist) . . (+1) . . Gleis Week 4 (Added week 4 assignment)
- 04:12, 20 September 2013 (diff | hist) . . (+2,636) . . N Gleis Week 4 (Created page with "=="Taken to the Next Level"== # :a) ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcg gtcgcagagttggttacgctcattaccccgctgccgataaggaatttttcgc gtcaggtaacgcccatcgtttatctc...")
- 03:53, 20 September 2013 (diff | hist) . . (+1) . . m Template:Workstuff
- 03:52, 20 September 2013 (diff | hist) . . (+17) . . m Template:Workstuff (new assignment)
- 05:20, 17 September 2013 (diff | hist) . . (+28) . . Gleis Week 3 (Added category) (top)
- 05:18, 17 September 2013 (diff | hist) . . (+48) . . Gleis Week 3
- 05:18, 17 September 2013 (diff | hist) . . (+32) . . Gleis Week 3
- 05:17, 17 September 2013 (diff | hist) . . (+12) . . Template:Workstuff
- 04:20, 17 September 2013 (diff | hist) . . (+99) . . User:Gleis (Added coursework)
- 23:46, 12 September 2013 (diff | hist) . . (0) . . m User:Gleis
- 23:43, 12 September 2013 (diff | hist) . . (+202) . . User:Gleis (Added work experience)
- 23:35, 12 September 2013 (diff | hist) . . (+4) . . User:Gleis (Formatting)
- 18:47, 12 September 2013 (diff | hist) . . (+277) . . Class Journal Week 3
- 18:44, 12 September 2013 (diff | hist) . . (+717) . . Gleis Week 3 (→XMLPIPEDB MATCH: finished match practice)
- 18:16, 12 September 2013 (diff | hist) . . (0) . . m Gleis Week 3 (→XMLPIPEDB MATCH)
- 18:14, 12 September 2013 (diff | hist) . . (+2) . . m Gleis Week 3 (→XMLPIPEDB MATCH)
- 18:13, 12 September 2013 (diff | hist) . . (+5) . . Gleis Week 3 (formatting)
- 18:11, 12 September 2013 (diff | hist) . . (+764) . . Gleis Week 3 (Genetic code by computer commands)
- 17:54, 12 September 2013 (diff | hist) . . (+6) . . m Gleis Week 3
- 17:53, 12 September 2013 (diff | hist) . . (+2) . . Gleis Week 3
- 17:53, 12 September 2013 (diff | hist) . . (+179) . . Gleis Week 3 (started assignment)
- 16:57, 12 September 2013 (diff | hist) . . (+19) . . N Gleis Week 3 (Created page with "==XMLPIPEDB MATCH==")
- 16:57, 12 September 2013 (diff | hist) . . (+18) . . Template:Workstuff (Added week 3 Journal page)
- 06:36, 12 September 2013 (diff | hist) . . (+26) . . Template:Workstuff
- 06:24, 12 September 2013 (diff | hist) . . (+308) . . Class Journal Week 3
- 02:16, 11 September 2013 (diff | hist) . . (+74) . . Gleis Week 2 (Edited page to include code past stop codons) (top)
- 04:03, 6 September 2013 (diff | hist) . . (-17) . . m Template:Workstuff
- 04:01, 6 September 2013 (diff | hist) . . (+79) . . Gleis Week 2 (Finished Assingment, Added signature)
- 04:01, 6 September 2013 (diff | hist) . . (+67) . . Gleis Week 2
- 03:49, 6 September 2013 (diff | hist) . . (+208) . . Gleis Week 2
- 03:12, 6 September 2013 (diff | hist) . . (+1) . . Gleis Week 2 (→The Genetic Code)
- 03:11, 6 September 2013 (diff | hist) . . (+67) . . Gleis Week 2 (complementary strand)
- 03:10, 6 September 2013 (diff | hist) . . (+94) . . Gleis Week 2 (started assignment)
- 18:55, 5 September 2013 (diff | hist) . . (+29) . . Gleis Week 2
- 18:53, 5 September 2013 (diff | hist) . . (0) . . Template:Workstuff
- 18:53, 5 September 2013 (diff | hist) . . (+18) . . Template:Workstuff
- 18:48, 5 September 2013 (diff | hist) . . (-11) . . User:Gleis
- 18:48, 5 September 2013 (diff | hist) . . (+12) . . Template:Workstuff
- 18:44, 5 September 2013 (diff | hist) . . (-1) . . User:Gleis
- 18:44, 5 September 2013 (diff | hist) . . (+1) . . User:Gleis
- 18:43, 5 September 2013 (diff | hist) . . (+12) . . m User:Gleis
- 18:41, 5 September 2013 (diff | hist) . . (+32) . . N Gleis Week 2 (Created page with "==Week 2 Individual Assignment==")
- 18:41, 5 September 2013 (diff | hist) . . (+18) . . Weekly Work (top)
- 04:36, 5 September 2013 (diff | hist) . . (0) . . Template:Workstuff
- 04:34, 5 September 2013 (diff | hist) . . (+26) . . Template:Workstuff (Added link to journal)
- 04:33, 5 September 2013 (diff | hist) . . (+1,171) . . Class Journal Week 2
- 18:23, 3 September 2013 (diff | hist) . . (+1) . . User:Gleis
- 18:23, 3 September 2013 (diff | hist) . . (+34) . . User:Gleis
- 18:22, 3 September 2013 (diff | hist) . . (-1) . . m User:Gleis (Format Change)
- 18:21, 3 September 2013 (diff | hist) . . (+1) . . User:Gleis (Color Change)
- 18:20, 3 September 2013 (diff | hist) . . (+195) . . User:Gleis
- 18:16, 3 September 2013 (diff | hist) . . (-2) . . User:Gleis
- 18:16, 3 September 2013 (diff | hist) . . (+7) . . User:Gleis
- 18:14, 3 September 2013 (diff | hist) . . (0) . . Template:Workstuff
- 19:33, 31 August 2013 (diff | hist) . . (-1) . . User:Gleis
- 19:28, 31 August 2013 (diff | hist) . . (-6) . . User:Gleis
- 19:28, 31 August 2013 (diff | hist) . . (-10) . . User:Gleis
- 19:27, 31 August 2013 (diff | hist) . . (-15) . . User:Gleis (→Contact Me)
- 19:27, 31 August 2013 (diff | hist) . . (+16) . . User:Gleis
- 05:10, 30 August 2013 (diff | hist) . . (-356) . . User:Gleis (→Work Experience)
- 05:10, 30 August 2013 (diff | hist) . . (+6) . . User:Gleis (→Education)
- 05:09, 30 August 2013 (diff | hist) . . (+6) . . User:Gleis (→Education)
- 05:05, 30 August 2013 (diff | hist) . . (+1) . . User:Gleis (→Education)
- 05:05, 30 August 2013 (diff | hist) . . (+553) . . User:Gleis
- 05:02, 30 August 2013 (diff | hist) . . (+1) . . User:Gleis (→Work Experience)
- 05:01, 30 August 2013 (diff | hist) . . (+3) . . User:Gleis (→Education)
- 05:01, 30 August 2013 (diff | hist) . . (-122) . . User:Gleis (→Contact Me)
- 05:00, 30 August 2013 (diff | hist) . . (+322) . . User:Gleis
- 04:58, 30 August 2013 (diff | hist) . . (+3) . . User:Gleis
- 04:55, 30 August 2013 (diff | hist) . . (0) . . User:Gleis
- 04:54, 30 August 2013 (diff | hist) . . (0) . . User:Gleis
- 04:54, 30 August 2013 (diff | hist) . . (0) . . User:Gleis
- 04:54, 30 August 2013 (diff | hist) . . (0) . . User:Gleis
- 04:54, 30 August 2013 (diff | hist) . . (0) . . User:Gleis
- 04:53, 30 August 2013 (diff | hist) . . (0) . . User:Gleis
- 04:53, 30 August 2013 (diff | hist) . . (0) . . User:Gleis
- 04:53, 30 August 2013 (diff | hist) . . (0) . . User:Gleis
- 04:48, 30 August 2013 (diff | hist) . . (+1) . . User:Gleis
- 04:47, 30 August 2013 (diff | hist) . . (-1) . . User:Gleis
- 04:47, 30 August 2013 (diff | hist) . . (-35) . . User:Gleis
- 04:46, 30 August 2013 (diff | hist) . . (+227) . . User:Gleis
- 04:43, 30 August 2013 (diff | hist) . . (-153) . . User:Gleis
- 04:43, 30 August 2013 (diff | hist) . . (+120) . . User:Gleis
- 04:41, 30 August 2013 (diff | hist) . . (+1) . . User:Gleis
- 04:39, 30 August 2013 (diff | hist) . . (+1) . . User:Gleis
- 04:37, 30 August 2013 (diff | hist) . . (-1) . . User:Gleis
- 04:37, 30 August 2013 (diff | hist) . . (0) . . User:Gleis
- 04:36, 30 August 2013 (diff | hist) . . (+9) . . User:Gleis
- 04:36, 30 August 2013 (diff | hist) . . (+23) . . User:Gleis
- 01:44, 30 August 2013 (diff | hist) . . (-24) . . User:Gleis
- 01:43, 30 August 2013 (diff | hist) . . (-16) . . User:Gleis (Editied for redundancy)
- 01:42, 30 August 2013 (diff | hist) . . (+23) . . User:Gleis
- 01:41, 30 August 2013 (diff | hist) . . (+28) . . Template:Workstuff
- 01:40, 30 August 2013 (diff | hist) . . (+86) . . N Template:Workstuff (New Template)
- 01:37, 30 August 2013 (diff | hist) . . (+24) . . User:Gleis
- 01:36, 30 August 2013 (diff | hist) . . (+36) . . User:Gleis
- 01:33, 30 August 2013 (diff | hist) . . (+48) . . User:Gleis (addition of categories to page)
- 01:31, 30 August 2013 (diff | hist) . . (0) . . User:Gleis
- 01:30, 30 August 2013 (diff | hist) . . (+50) . . User:Gleis
- 01:28, 30 August 2013 (diff | hist) . . (+16) . . N File:Presentation1.ppt (Chem Seminar ppt) (top)
- 01:26, 30 August 2013 (diff | hist) . . (+15) . . User:Gleis
- 01:20, 30 August 2013 (diff | hist) . . (-10) . . User:Gleis (new photo)
- 01:20, 30 August 2013 (diff | hist) . . (+6) . . N File:VC.jpg (CV pic) (top)
- 01:15, 30 August 2013 (diff | hist) . . (+8) . . N File:Resume-photo.jpg (CV photo) (top)
- 01:14, 30 August 2013 (diff | hist) . . (+27) . . User:Gleis
- 01:11, 30 August 2013 (diff | hist) . . (+20) . . N File:1044595 10151786173603385 1581126295 n.jpg (Classy photo of self) (top)
- 01:08, 30 August 2013 (diff | hist) . . (+6) . . User:Gleis (edited size of name)
- 01:05, 30 August 2013 (diff | hist) . . (-2) . . User:Gleis
- 01:04, 30 August 2013 (diff | hist) . . (+71) . . User:Gleis
- 01:02, 30 August 2013 (diff | hist) . . (+10) . . User:Gleis (→Contact Me: edited address information to include number scheme)
- 00:59, 30 August 2013 (diff | hist) . . (+83) . . User:Gleis (→Interests)
- 00:54, 30 August 2013 (diff | hist) . . (+33) . . N Weekly Work (Created page with "Week 1 Class Journal Week 1")
- 00:53, 30 August 2013 (diff | hist) . . (+17) . . User:Gleis
- 00:51, 30 August 2013 (diff | hist) . . (+1,418) . . Class Journal Week 1
- 00:04, 30 August 2013 (diff | hist) . . (+740) . . Class Journal Week 1 (Pre-reading questions)
- 23:38, 29 August 2013 (diff | hist) . . (+109) . . User talk:Dondi
- 23:33, 29 August 2013 (diff | hist) . . (+158) . . User talk:Kdahlquist
- 23:11, 29 August 2013 (diff | hist) . . (+3) . . User:Gleis (→Interests)
- 23:11, 29 August 2013 (diff | hist) . . (+29) . . User:Gleis (Interests and minor formatting changes)
- 23:06, 29 August 2013 (diff | hist) . . (+16) . . User:Gleis
- 18:17, 29 August 2013 (diff | hist) . . (0) . . User:Gleis (→Contact Me)
- 18:17, 29 August 2013 (diff | hist) . . (+29) . . m User:Gleis
- 18:16, 29 August 2013 (diff | hist) . . (+12) . . m User:Gleis (Boldened employers)
- 18:15, 29 August 2013 (diff | hist) . . (-2) . . m User:Gleis
- 18:15, 29 August 2013 (diff | hist) . . (+292) . . User:Gleis (Added work experience)
- 18:11, 29 August 2013 (diff | hist) . . (+137) . . User:Gleis (Added contact section and updated academic info)
- 18:04, 29 August 2013 (diff | hist) . . (-96) . . m User:Gleis (removal of signature)
- 17:43, 29 August 2013 (diff | hist) . . (+10) . . Main Page (Added link to main page)
- 17:39, 29 August 2013 (diff | hist) . . (+21) . . User:Gleis
- 17:37, 29 August 2013 (diff | hist) . . (+12) . . User:Student13 (top)
- 17:36, 29 August 2013 (diff | hist) . . (+15) . . N User:Student13 (Created page with "User: Gleis")
- 17:29, 29 August 2013 (diff | hist) . . (+23) . . User:Gleis
- 17:21, 29 August 2013 (diff | hist) . . (+75) . . User:Gleis
- 17:10, 29 August 2013 (diff | hist) . . (0) . . User:Gleis
- 17:08, 29 August 2013 (diff | hist) . . (+42) . . User:Gleis
- 17:07, 29 August 2013 (diff | hist) . . (+17) . . N File:Strawberry.gif (I <3 strawberries) (top)
- 17:06, 29 August 2013 (diff | hist) . . (+11) . . User:Gleis
- 16:54, 29 August 2013 (diff | hist) . . (+77) . . User:Gleis (beginning user page)
- 16:50, 29 August 2013 (diff | hist) . . (+19) . . User:Gleis
- 16:42, 29 August 2013 (diff | hist) . . (-32) . . m User:Gleis (removed wikiiiiiiiiiii!!!!!!!!)
- 16:40, 29 August 2013 (diff | hist) . . (+32) . . N User:Gleis (Im just joshin with ya wiki!)