Zvanysse Week 2

Week 2 Assignment Page

Original Strand

5’- cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta - 3’

Translating T's to U's

5’ – cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua – 3’

Translating to Amino Acids

+1

5’- R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L – 3’ OPEN

+2

5’ – V-C-Stop-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F – 3’

+3

5’ – Y-A-N-T-M-F-R-V-Stop-P-S-R-Q-F-R-W-R-H-F – 3’

Complementary Strands

3’ – gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau - 5’

Careful! Reading backwards

-1

5' -Stop-N-A-S-G-T-G-G-Stop-V-I-R-G-T-Stop-Y-Stop-H-T - 3'

-2

5’ – K-M-P-P-A-E-L-A-A-G-L-Y-A-E-H-G-I-S-I – 3’ OPEN

-3

5’ – K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y – 3’ OPEN

Acknowledgments

• Worked with Corinne Wong on understanding how to read the DNA strands
• Emailed Dahlquist for clarification on the assignment

Zvanysse (talk) 09:38, 11 September 2017 (PDT)

References

• LMU BioDB 2017. (2017). Week 2. Retrieved September 9, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_2
• Amino Acid Chart