Lena Week 4

From LMU BioDB 2013
Jump to: navigation, search
  1. Modify the gene sequence string so that it highlights or “tags” the special sequences within this gene, as follows (ellipses indicate bases in the sequence; note the spaces before the start tag and after the end tag):
    • -35 and -10 box of the promoter
      • cat infA-E.coli-K12.txt | sed "s/cat[at]at/ <minus10box>&<\/minus10box> /g" | sed -r "s/.{17} <\/minus10/<\/minus35box> &/g" | sed "s/tt[gt]ac[at]<\/minus35box>/ <minus35box>&/g"
    • transcription start site
      • cat infA-E.coli-K12.txt | sed "2s/atg/<tss>&<\/tss> /1"
    • ribosome binding site
      • cat infA-E.coli-K12.txt | sed "s/gagg/ <rbs>&<\/rbs> /g"
    • start codon
      • cat infA-E.coli-K12.txt | sed "2s/atg/ <start_codon>&<\/start_codon> /g"
    • stop codon (*Note: not final answer)
      • cat infA-E.coli-K12.txt | sed "s/tga/ <stop_codon>&<\/stop_codon> /7"
    • terminator
      • cat infA-E.coli-K12.txt | sed "s/aaaaggt...........gcctttt..../ <terminator>&<\/terminator> /g"
  2. What is the exact mRNA sequence that is transcribed from this gene?
    • cgguuucuucuguuauaacuuuacguuccauggcaagaacuuugcaacggauuaugguacaaggcgcaucucaaucuuuugccagugcaccaaugacguguguagaggccauuuuacgcguuuuugauguaggcguaggacugcccgcuguuucacugacaacuugacuggggcaugcugg
  3. What is the amino acid sequence that is translated from this mRNA?
    • The amino acid sequence is Met A K E D N I E Met Q G T V L E T L P N T Met F R V E L E N G H V V T A H I S G K Met R K N Y I R I L T G D K V T V E L T P Y D L


  • All commands in one string
cat infA-E.coli-K12.txt | sed "s/cat[at]at/ <minus10box>&<\/minus10box> /g" | sed -r "s/.{17} <\/minus10/<\/minus35box> &/g" | sed "s/tt[gt]ac[at]<\/minus35box>/ <minus35box>&/g" | sed "s/gagg/ <rbs>&<\/rbs> /g" | sed "s/<\/rbs>/&\n/g" | sed "2s/atg/ <start_codon>&<\/start_codon> /1" | sed "s/.../ \n /3" | sed "s/aaaaggt...........gcctttt..../ <terminator>&<\/terminator> /g" | sed "2s/atg/<tss>&<\/tss> /1" | sed "s/tga/ <stop>&<\/stop> /7" | sed "y/atcg/uagc/"


Lena Hunt

Personal tools
Namespaces

Variants
Actions
Navigation
Toolbox