Dbashour Week 3

From LMU BioDB 2017
Jump to: navigation, search

Screenshots of changed text

Welcome to dina's empire with details.png Welcome to dina's empire.png

Screenshots of changed picture

Changed picture with details.png Changed picture.png

Curl Command used to retrieve info:

curl -X POST -d "pre_text=cgatggtacatggagtccagtagccgtagtgatgagatcgatgagctagc&output=Verbose&code=Standard&submit=Submit" http://web.expasy.org/cgi-bin/translate/dna_aa

Command used to get "just the answers"

curl -X POST -d "pre_text=cgatggtacatggagtccagtagccgtagtgatgagatcgatgagctagc&output=Verbose&code=Standard&submit=Submit" http://web.expasy.org/cgi-bin/translate/dna_aa | sed "1,47d" | sed "13q" | sed "s/<[^>]*>//g"

Links to other pages:

  1. http://www.w3.org/TR/html4/loose.dtd
    • A HTML document "which includes presentation attributes and elements that W3C expects to phase out as support for style sheets matures"
  2. http://web.expasy.org/favicon.ico
    • A picture of the logo used on the page tab
  3. /css/sib_css/sib.css
    • A template laying out how the page should be formatted
  4. /css/sib_css/sib_print.css
    • A template laying out how the page should be formatted for printing
  5. /css/base.css
    • Another template for laying out the format of the page
  6. http://www.isb-sib.ch
    • Link to Swiss Institute of Bioinformatics Homepage
  7. http://www.expasy.org
    • Link to the ExPasy Bioinformatics Resource Portal Home
  8. http://web.expasy.org/translate
    • Link to the Translate Tool page (without any input in)
  9. http://en.wikipedia.org/wiki/Open_reading_frame
    • Wikipedia page for open reading frame
  10. http://web.expasy.org/cgi-bin/translate/dna_sequences?/work/expasy/tmp/http/seqdna.28321,1
    • ExPASy translate tool highlighting open reading frames for frame 1
  11. http://web.expasy.org/cgi-bin/translate/dna_sequences?/work/expasy/tmp/http/seqdna.28321,2
    • ExPASy translate tool highlighting open reading frames for frame 2
  12. http://web.expasy.org/cgi-bin/translate/dna_sequences?/work/expasy/tmp/http/seqdna.28321,3
    • ExPASy translate tool highlighting open reading frames for frame 3
  13. http://web.expasy.org/cgi-bin/translate/dna_sequences?/work/expasy/tmp/http/seqdna.28321,4
    • ExPASy translate tool highlighting open reading frames for frame 1
  14. http://web.expasy.org/cgi-bin/translate/dna_sequences?/work/expasy/tmp/http/seqdna.28321,5
    • ExPASy translate tool highlighting open reading frames for frame 2
  15. http://web.expasy.org/cgi-bin/translate/dna_sequences?/work/expasy/tmp/http/seqdna.28321,6
    • ExPASy translate tool highlighting open reading frames for frame 3
  16. http://www.isb-sib.ch
    • Swiss Institute of Bioinformatics link at bottom of page
  17. https://www.expasy.org/disclaimer.html
    • ExPASy disclaimer
  18. https://www.google-analytics.com/ga.js
    • Java script code used within the website

Identifiers:

  1. sib_top
    • The very top of the page
  2. sib_container
    • The container for the whole page returned
  3. sib_header_small
    • The small bar header at the top of the page
  4. sib_expasy_logo
    • The logo in the top left corner of the page
  5. resource_header
    • Not obvious, but possibly another formatting section for the header of the page
  6. sib_header_nav
    • The top right of the page with navigational buttons to home and contact
  7. sib_body
    • The portion of the page including the text and reading frames returned
  8. sib_footer
    • The footer at the bottom of the page
  9. sib_footer_content
    • The text/content included in the footer at the bottom of the page
  10. sib_footer_right
    • The text/content in the bottom right footer of the page
  11. sb_footer_gototop
    • The button going to the top of the page included in the footer

Acknowledgements

I worked with my homework partner Quinn Lanners on this homework assignment. We communicated via text to help eachother with the decoding of the DNA strand. While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.

References

LMU BioDB 2017. (2017). Week 1. Retrieved August 29, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_3

Dbashour (talk) 15:44, 19 September 2017 (PDT) Dina Bashoura

Biological Databases Homepage

List of Assignments

List of Individual Journal Entries

List of Shared Journal Entries

List of Final Assignments

List of Team Journal Assignments

Retrieved from "https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php?title=Dbashour_Week_3&oldid=1467"